Pageblue

Unless otherwise stated, chemicals and reagents were purchased from Sigma-Aldrich Quimica S.A. (Madrid, Spain). Sydney IVF Sperm Medium was provided by Cook Medical (Barcelona, Spain). 4–15% polyacrylamide gels were supplied by Bio-Rad (Madrid, Spain) and PVDF membranes by Merck (Madrid, Spain). The primary antibodies were: anti-phospho-PKA substrates (PKAs-P) (Cell Signaling Technology, Beverly, USA, #9624), anti-phosphotyrosine (Tyr-P) (Abcam, Cambridge, UK, #ab10321) and anti-β-tubulin (β-TUB) (Sigma-Aldrich Quimica S.A., Madrid, Spain, #T0198)^{78 (link),79 (link)}. Horseradish peroxidase-conjugated anti-rabbit and anti-mouse IgGs were obtained from Santa Cruz Biotechnology (Heidelberg, Germany, #sc2004) and Bio-Rad (Madrid, Spain, #1706516), respectively. PageBlue was provided by Thermo Scientific (Rockford, IL, USA), whereas acetonitrile, trifluoroacetic acid and formic acid by Fisher Scientific (UK). Trypsin Gold Proteomics Grade and ProteaseMax surfactant were purchased from Promega Corporation (Madison, MI, USA).

ApoB-depleted serum (2 µL) was separated by native gradient gel electrophoresis (4–16% NativePage; Life Technologies, Carlsbad, CA, USA). The gels were run for 120 min at constant voltage of 150 in NativePage running buffer (Life Technologies, Carlsbad, CA, USA). Subsequently, standard (NativeMark, Life Technologies, Carlsbad, CA, USA) of the gels was fixed with 25% isopropanol/10% acetic acid for 10 min and stained with protein staining solution (PageBlue, Thermo Scientific, Waltham, MA, USA). Separated neutral lipids of the samples were stained with Sudan black (Sigma-Aldrich, Darmstadt, Germany). Size distribution of HDL was analyzed using Image Lab software (version 5.2), as described previously [35 (link)].

Synthetic genes encoding the nucleoproteins of SARS-CoV-2 (GenBank accession NC_045512.2), SARS-CoV (AY278491.2), MERS-CoV (JX869059.2), HCoV-HKU1 (KY674943.1), HCoV-OC43 (MN306053.1), HCoV-229E (KY621348.1), and HCoV-NL63 (KY554967.1) were obtained from GeneArt. Genes were cloned into pBVboost plasmid with N-terminal glutathione S-transferase (GST) and proteins were produced in Spodoptera frugiperda (Sf-9) cells and purified as described earlier [16 (link)]. Protein purity and concentration were estimated with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Page Blue (Thermo Fischer Scientific) staining with known amounts of bovine serum albumin protein as standards.

MMP-2 activity was determined by gelatin gel zymography. In brief, the conditioned media were concentrated, and equal volumes were used for native gel electrophoresis. After resolving, the gel was incubated in 2.5% Triton X-100 for 1 hour before incubation in buffer that contained 10 mmol/L calcium chloride, 200 mmol/L sodium chloride, and 50 mmol/L Tris hydrochloride overnight at 37°C. The gel was stained with PAGE blue (ThermoFisher Scientific, Waltham, MA) overnight before destaining with water.

PCR was performed on M13 plasmid using primers iVHH-FW (CGGAATTCCTTTAGTTGTTCCA), and iVHH-Rev (CACATCATCATCACCATCACG), or nVHH-FW (CGCTGGATTGTTATTACTCGC) and nVHH-Rev (CCTCAGAACCCAAGACCA). PCR fragments were cloned into pUR5850 [23 (link)] by SfiI and BstEII (Fermentas) digestion and ligation. Clones were verified by sequence analysis and transferred into Neb5 E. coli for production. VHH were purified using the His6-tag with TALON metal affinity resin (Clontech, Mountain View CA, USA) according to the manufacturer’s instructions using 50 mM NaPO4, 0.3 M NaCl, pH7 as wash buffer. Wash buffer with 150 mM imidazole was used as elution buffer. Pooled eluates were dialyzed against PBS using Cellu-Sep dialyze-tube MWCO 3500 (Interchim, MontluÇon, France). VHH production was checked on Coomassie staining (PageBlue, Thermo-Scientific) and western blotting against the VSV-tag. VHH was quantified with bicinchoninic assay (BCA, Thermo-Scientific). VHH were stored in 5 % glycerol at −20 °C.

After co-immunoprecipitation, samples were resolved using a 10% Tris-Glycine SDS-PAGE and proteins were visualized using PageBlue (Thermo Scientific, 24620). Bands of interest were cut out from the gel and digested with trypsin (50ng/μl in 50 mM NH4HCO3 buffer, PH 8.0). The peptides were analyzed, as previously described [40 (link)], by capillary LC-tandem mass spectrometry in a LTQ XL ion trap mass spectrometer (ThermoScientific, San Jose, CA) fitted with a microelectrospray probe. The data were analyzed with the ProteomeDiscoverer software (ThermoScientific, version 1.4.1), and the proteins were identified with SequestHT against a target-decoy nonredundant human or mouse proteins database obtained from Uniprot. The following parameters were used: trypsin was selected with proteolytic cleavage only after arginine and lysine, number of internal cleavage sites was set to 1, mass tolerance for precursors and fragment ions was 1.0 Da, considered dynamic modifications were + 15.99 Da for oxidized methionine. Peptide matches were filtered using the q-value and Posterior Error Probability calculated by the Percolator algorithm ensuring an estimated false positive rate below 5%. The filtered Sequest HT output files for each peptide were grouped according to the protein from which they were derived.

The co-elution studies were performed on a Äkta Micro system using a Superdex 200 PC 3.2 column (GE Healthcare) equilibrated with 50 mM HEPES-NaOH, pH 7.5, 500 mM NaCl with a flow rate of 0.05 mL/min.
A 50 μL reaction mixture consisting of 20 μM NisB, 160 μM NisC and 200 μM prenisin peptide variant was incubated for 1 h at 25 °C and subsequently applied to SEC analysis. Elution was observed at 280 nm. After co-elution, the corresponding fractions were analyzed by a 4–20% gradient Tris-Glycine SDS-PAGE (Biorad) gel stained with Page-Blue (Thermo Fisher).