Shcont shc002

Manufactured by Merck Group

Sourced in Sao Tome and Principe

ShCONT: SHC002 is a laboratory equipment product offered by Merck Group. It serves as a versatile platform for various applications. The core function of this product is to provide a controlled environment for experiments and analyses, but a detailed description cannot be provided while maintaining an unbiased and factual approach.

Automatically generated - may contain errors

Lab products found in correlation

Pci vsvg, by Addgene (4 mentions) Pcmv dr8.2 dvpr, by Addgene (4 mentions) Pcdh mcs t2a puro mscv vector, by System Biosciences (2 mentions) Complete neurobasal medium, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Lenticrispr v2 plasmid, by Addgene (1 mentions)

4 protocols using shcont shc002

Lentiviral shRNA and Overexpression Knockdown

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral clones expressing two, non-overlapping shRNAs directed against human c-Myc (TRCN0000039640, TRCN0000039642), human HMGCR (TRCN0000233114, TRCN0000233115) or a non-targeting control shRNA that has no targets in human genomes (shCONT: SHC002) were obtained from Sigma-Aldrich (St. Louis, MO). shRNAs with non-overlapping sequences that had the best relative knockdown efficiency were used for all experiments. A lentiviral overexpression plasmid for MYC was generated by cloning the ORF with the N-terminal Flag into the pCDH-MCS-T2A-Puro-MSCV vector (System Biosciences) (24 (link)). Lentiviral particles were generated in 293FT cells in Neurobasal complete medium (Life Technologies) with co-transfection of the packaging vectors pCMV-dR8.2 dvpr and pCI-VSVG (Addgene) using a standard calcium phosphate transfection method.

Wang X., Huang Z., Wu Q., Prager B.C., Mack S.C., Yang K., Kim L.J., Gimple R.C., Shi Y., Lai S., Xie Q., Miller T.E., Hubert C.G., Song A., Dong Z., Zhou W., Fang X., Zhu Z., Mahadev V., Bao S, & Rich J.N. (2017). MYC-regulated Mevalonate Metabolism Maintains Brain Tumor Initiating Cells. Cancer research, 77(18), 4947-4960.

+ Open protocol

+ Expand

Lentiviral Knockdown and Overexpression Toolkit

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral clones expressing shRNAs directed against human ADSL (TRCN0000078271, TRCN0000078272), human GMPS (TRCN0000045939, TRCN0000045940), human PRPS1 (TRCN0000010123, TRCN0000010125), murine Adsl (TRCN0000120128, TRCN0000339620), murine Gmps (TRCN0000251162, TRCN0000251160), murine Prps1 (TRCN0000024886, TRCN0000024888), human MYC (TRCN0000039640, TRCN0000039642), human GLUT3 (TRCN0000043616, TRCN0000043615) or a control shRNA that has no targets in either human or mouse genome (shCont: SHC002) were obtained from Sigma-Aldrich (St. Louis, MO). shRNAs with non-overlapping sequences that had the best relative knockdown efficiency were used for all experiments. Lentiviral overexpression plasmid for human MYC was generated by cloning the ORF with the N-terminal Flag into the pCDH-MCS-T2A-Puro-MSCV vector (System Biosciences)^{51 (link)}. Lentiviral particles were generated in 293FT cells in Neurobasal complete medium (Life Technologies) with cotransfection with the packaging vectors pCMV-dR8.2 dvpr and pCI-VSVG (Addgene) using standard calcium phosphate transfection.

Wang X., Yang K., Xie Q., Wu Q., Mack S.C., Shi Y., Kim L.J., Prager B.C., Flavahan W.A., Liu X., Singer M., Hubert C.G., Miller T.E., Zhou W., Huang Z., Fang X., Regev A., Suvà M.L., Hwang T.H., Locasale J.W., Bao S, & Rich J.N. (2017). Purine synthesis promotes maintenance of brain tumor initiating cells in glioma. Nature neuroscience, 20(5), 661-673.

+ Open protocol

+ Expand

Lentiviral shRNA and CRISPR Knockdown of ALKBH1 and N6AMT1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral clones to express shRNA directed against ALKBH1
(shALKBH1.1008:TRCN0000235019, shALKBH1.1551: TRCN0000146838), or a control
shRNA insert that does not target human and mouse genes (shCONT, SHC002)
were obtained from Sigma-Aldrich (St. Louis, MO). The CRISPR design tool
from ChopChop (http://chopchop.cbu.uib.no/index.php) was used to design the
guide RNA (gRNA). Oligonucleotides were purchased from Fisher, and annealed
and cloned into LentiCRISPR v2 plasmid, which was a gift from Dr. Feng Zhang
(Addgene, plasmid 52961). The target sequence for SgRNAs used were as
follows: ALKBH1 SgRNA#4: TCCGCTTCTACCGTCAGAGC, ALKBH1 SgRNA#5:
GATCCTGAATTACTACCGCC. N6AMT1 SgRNA#1: GGGCTCGTACACGTCGCTGA, SgRNA#2:
AAGCAGAAACGTGTCCTCCG, SgRNA#3: GGGCTGGTGGCAGAAATGGT, SgRNA#4:
TTGAGGTGGAGTCACTACAT. Lentiviral particles were generated in 293FT cells in
stem cell media with co-transfection with the packaging vectors pCMV-dR8.2
dvpr and pCI-VSVG (Addgene, Cambridge, MA) by Lipofectamine 2000
(Invitrogen).

Xie Q., Wu T.P., Gimple R.C., Li Z., Prager B.C., Wu Q., Yu Y., Wang P., Wang Y., Gorkin D.U., Zhang C., Dowiak A.V., Lin K., Zeng C., Sui Y., Kim L.J., Miller T.E., Jiang L., Lee-Poturalski C., Huang Z., Fang X., Zhai K., Mack S.C., Sander M., Bao S., Kerstetter-Fogle A.E., Sloan A.E., Xiao A.Z, & Rich J.N. (2018). N6-methyladenine DNA Modification in Glioblastoma. Cell, 175(5), 1228-1243.e20.

+ Open protocol

+ Expand

Lentiviral Knockdown of CDC20 and FOXM1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral clones to express shRNA directed against CDC20 (TRCN0000003790, TRCN0000284991), FOXM1 (TRCN0000015544, TRCN0000015546), or a control shRNA insert that does not target human and mouse genes (shCONT, SHC002) were obtained from Sigma-Aldrich (St. Louis, MO). shRNAs with non-overlapping sequences that had the best relative knockdown efficiency were used for all experiments. Tet-on CDC20 expression plasmid was a gift from Dr. Wenyi Wei (Harvard). Lentiviral particles were generated in 293FT cells in stem cell media with co-transfection with the packaging vectors pCMV-dR8.2 dvpr and pCI-VSVG (Addgene) by Lipofectamine 2000 (Invitrogen).

Xie Q., Wu Q., Mack S.C., Yang K., Kim L., Hubert C.G., Flavahan W.A., Chu C., Bao S, & Rich J.N. (2015). CDC20 maintains tumor initiating cells. Oncotarget, 6(15), 13241-13254.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!