Log In Sign up
The largest database of trusted experimental protocols

Beadbug homogenizer

Manufactured by Benchmark Scientific
Visit Supplier
Sourced in United States

The BeadBug homogenizer is a laboratory instrument designed for the efficient homogenization of biological samples. It utilizes rapid oscillatory motion to thoroughly disrupt and blend a variety of sample types, including tissue, cells, and microorganisms, in preparation for downstream analysis.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions) Rneasy mini kit, by Qiagen (3 mentions) D8938, by Thermo Fisher Scientific (2 mentions) Triplepure m bio grade, by Benchmark Scientific (2 mentions) Matrigel, by BD (2 mentions) Zirconium beads, by Benchmark Scientific (2 mentions) Rneasy plus universal mini kit, by Qiagen (2 mentions) Anti rabbit secondary antibody, by Cell Signaling Technology (2 mentions) Cleaved caspase 3 antibody, by Cell Signaling Technology (2 mentions) Amersham hybond 0.45 pvdf membranes, by GE Healthcare (2 mentions) Hrp conjugated anti β actin antibody, by Proteintech (2 mentions) Clarity or clarity max western ecl blotting substrates, by Bio-Rad (2 mentions) Tri reagent, by Merck Group (2 mentions) Dulbecco s modified eagle s medium, by BD (1 mentions) Lysis matrix d, by MP Biomedicals (1 mentions) Fetal bovine serum (fbs), by MP Biomedicals (1 mentions) Penicillin streptomycin, by MP Biomedicals (1 mentions) Tri reagent, by Zymo Research (1 mentions) Direct zol rna miniprep plus kit, by Zymo Research (1 mentions) Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)

31 protocols using beadbug homogenizer

1

Brain Tissue Homogenization for rAAV Genome Recovery

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Half of a frozen brain hemisphere (0.3 g approx.) was homogenized with a 2 ml glass homogenizer (Sigma Aldrich; D8938) or a motorized plastic pestle (Fisher Scientific;12-141-361, 12-141-363) (for smaller tissues) or beads using BeadBug Homogenizers (1.5–3.0 mm zirconium or steel beads per manufacturer recommendations) (Homogenizers, Benchmark Scientific, D1032–15, D1032–30, D1033–28) and processed using Trizol as described in our prior work26 (link) (also see Supplementary Note 17). From deep sequencing data analysis, we observed that the amount of tissue processed was sufficient for rAAV genome recovery.
Kumar S.R., Miles T.F., Chen X., Brown D., Dobreva T., Huang Q., Ding X., Luo Y., Einarsson P.H., Greenbaum A., Jang M.J., Deverman B.E, & Gradinaru V. (2020). Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types. Nature methods, 17(5), 541-550.
+ Open protocol
+ Expand
2

Brain Tissue Homogenization for rAAV Genome Recovery

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Half of a frozen brain hemisphere (0.3 g approx.) was homogenized with a 2 ml glass homogenizer (Sigma Aldrich; D8938) or a motorized plastic pestle (Fisher Scientific;12-141-361, 12-141-363) (for smaller tissues) or beads using BeadBug Homogenizers (1.5–3.0 mm zirconium or steel beads per manufacturer recommendations) (Homogenizers, Benchmark Scientific, D1032–15, D1032–30, D1033–28) and processed using Trizol as described in our prior work26 (link) (also see Supplementary Note 17). From deep sequencing data analysis, we observed that the amount of tissue processed was sufficient for rAAV genome recovery.
Kumar S.R., Miles T.F., Chen X., Brown D., Dobreva T., Huang Q., Ding X., Luo Y., Einarsson P.H., Greenbaum A., Jang M.J., Deverman B.E, & Gradinaru V. (2020). Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types. Nature methods, 17(5), 541-550.
+ Open protocol
+ Expand
3

Cultivating Rickettsia-Infected Insect Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
African green monkey kidney epithelial cells (Vero) were cultured in Dulbecco's modified Eagle's medium (BD Biosciences, Franklin Lake, NJ, USA) with 10% fetal bovine serum and 1% penicillin-streptomycin (MP Biomedicals, Santa Ana, CA, USA) at 37°C in a 5% CO2 environment. Three frozen insects from a Rickettsia-positive pool (South Dakota #2) were surface sterilized with 70% ethanol and 10% bleach and placed into tubes of ceramic beads containing 500 μL of cell medium (lysis matrix D; MP Biomedicals). The insects were then macerated at low speed on a BeadBug homogenizer (Benchmark Scientific, Sayreville, NJ, USA) and the homogenate was inoculated into a T25 flask that was ∼50% confluent. Three days after the initial inoculation, the medium was changed to antibiotic free medium and subsequent media changes occurred every 3–4 days. At multiple points following inoculation, culture supernatants and cells were checked for the presence of Rickettsia by PCR and Giemsa staining.
Potts R., Molina I., Sheele J.M, & Pietri J.E. (2020). Molecular detection of Rickettsia infection in field-collected bed bugs. New Microbes and New Infections, 34, 100646.
+ Open protocol
+ Expand
4

RNA Extraction from Cell Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
2 mL aliquots were extracted from experimental samples at day 0, 5 and 10 for RNA analysis. Each aliquot was centrifuged at 4500 rpm for 10 min and the supernatant was removed and discarded. Cells were then re-suspended in 300 μL of TRI reagent (Zymo Research, Irvine, CA) and homogenized in a Beadbug homogenizer (Benchmark Scientific, Edison, NJ) at 4000 rpm for 20s. Total RNA was extracted using the Direct-zol RNA miniprep plus kit (Zymo Research, Irvine, CA) following the manufacturer’s protocol. A DNAse digestion was performed on column during this procedure.
Machado M.C., Vimbela G.V., Silva-Oliveira T.T., Bose A, & Tripathi A. (2020). The response of Synechococcus sp. PCC 7002 to micro-/nano polyethylene particles - Investigation of a key anthropogenic stressor. PLoS ONE, 15(7), e0232745.
+ Open protocol
+ Expand
5

Quantitative Analysis of Muciniphila in Mouse Feces

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA was extracted from mouse faecal material after homogenisation with 1.5 mm zirconium beads using BeadBug homogenizer (Benchmark Scientific, Inc.). DNA isolation was performed using QiaAmp Fast DNA Stool Mini Kit (QIAGEN) following the manufacturer’s protocol. An amount of 10–20 ng of DNA was then used in qPCR reactions for A. muciniphila with specific primers (AM1: CAGCACGTGAAGGTGGGGAC, AM2: CCTTGCGGTTGGCTTCAGAT), and for total bacteria (UniF340: ACTCCTACGGGAGGCAGCAGT, UniR514: ATTACCGCGGCTGCTGGC) for normalisation. qPCR was performed in 7900HT Fast Real-Time PCR system using Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA).
Giannoudaki E., Hernandez-Santana Y.E., Mulfaul K., Doyle S.L., Hams E., Fallon P.G., Mat A., O’Shea D., Kopf M., Hogan A.E, & Walsh P.T. (2019). Interleukin-36 cytokines alter the intestinal microbiome and can protect against obesity and metabolic dysfunction. Nature Communications, 10, 4003.
+ Open protocol
+ Expand
6

RNA Isolation from Intestinal Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
The tissue samples were homogenized with a BeadBug homogenizer (Benchmark Scientific, Edison, NJ). Briefly, a piece of ileum and jejunum (30–40 mg) was removed from RNAlater and transferred to prefilled microtubes containing zirconium beads (1.5 mm; TriplePure M-Bio Grade; Benchmark Scientific). Lysis buffer (350 μL; RNeasy Mini Kit; Qiagen) was added, and the tissues homogenized for two minutes at the maximum speed. Each tissue was handled separately. Following homogenization, total RNA was isolated according to the instructions, eluted with 50 μL RNase-free water, and stored at -80°C.
Swaggerty C.L., Arsenault R.J., Johnson C., Piva A, & Grilli E. (2020). Dietary supplementation with a microencapsulated blend of organic acids and botanicals alters the kinome in the ileum and jejunum of Gallus gallus. PLoS ONE, 15(7), e0236950.
+ Open protocol
+ Expand
7

Xenograft Model for Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
For Xenograft, 2 × 106 of C4–2B cells were
suspended in 200 μL PBS with 50% Matrigel (BD Science) and injected
subcutaneously into the dorsal flank of the mice one week after surgical
castration. Mice were randomly divided into four different groups and
treated with 200 μL of vehicle control, Enz (10mg/kg), EPZ6438
(250mg/kg), or combination of Enz (10mg/kg) and EPZ6438 (250mg/kg) by oral
gavage. Enz were administered once a day and EPZ6438 were given twice a day.
Tumor volumes were measured with digital caliper once a week in a blinded
fashion and calculated with the formula, V = π/6 (length ×
width2). When tumor size reached ~1,000mm3, mice were
euthanized, tumors were excised and weighed. The effects of drug treatment
in suppressing target pathways were examined via western blot and
immunohistochemistry analysis. For western blot analysis, dissected tumor
were homogenized with standard glass beads (1.0mm) using BeadBug homogenizer
(Benchmark) in RIPA buffer supplemented with protease inhibitor and protein
were subjected for western blot analysis. For immunohistochemistry analysis,
tumor sections were fixed with formalin and embedded in paraffin.
Formalin-fixed and paraffin embedded tumor section were then stained with
Ki-67 and H3K27me3.
Kim J., Lee Y., Lu X., Song B., Fong K.W., Cao Q., Licht J.D., Zhao J.C, & Yu J. (2018). Polycomb- and Methylation-Independent Roles of EZH2 as a Transcription Activator. Cell reports, 25(10), 2808-2820.e4.
+ Open protocol
+ Expand
8

Quantification of Adipocyte Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Adipocytes in 2D culture were lysed in Trizol, and ECM-adipocyte cultures were homogenized with a BeadBug Homogenizer (Benchmark Scientific, Inc., Edison, NJ). RNA was extracted with the RNAEasy Fibrous Tissue MiniKit (Qiagen, Inc., Hilden, Germany). Equal amounts of input RNA were reverse-transcribed, and quantitative real-time polymerase chain reaction (PCR) was performed using Taqman primer-probes (Life Technologies, Inc., Carlsbad, CA) with actin as an endogenous control on a StepOnePlus thermocycler (Applied Biosystems, Inc., Foster City, CA). The 2-dCT method was used to calculate fold differences in transcript levels and setting undetermined values at dCT = 40.
Baker N.A., Muir L.A., Washabaugh A.R., Neeley C.K., Chen S.Y., Flesher C.G., Vorwald J., Finks J.F., Ghaferi A.A., Mulholland M.W., Varban O.A., Lumeng C.N, & O’Rourke R.W. (2017). Diabetes-Specific Regulation of Adipocyte Metabolism by the Adipose Tissue Extracellular Matrix. The Journal of Clinical Endocrinology and Metabolism, 102(3), 1032-1043.
+ Open protocol
+ Expand
9

Jejunum RNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue samples were homogenized with a BeadBug homogenizer (Benchmark Scientific, Edison, NJ). Briefly, a piece jejunum (30–40 mg) was removed from RNAprotect, transferred to prefilled microtubes containing zirconium beads (1.5 mm; TriplePure M-Bio Grade; Benchmark Scientific), lysis buffer (350 µL; RNeasy Mini Kit; Qiagen) was added, and the tissue was homogenized for 2 min at maximum speed. Total RNA was isolated from the homogenized tissue according to the manufacturer's instructions, eluted with 50 μL RNase-free water, and stored at −80°C.
Swaggerty C.L., Byrd JA I.I., Arsenault R.J., Perry F., Johnson C.N., Genovese K.J., He H., Kogut M.H., Piva A, & Grilli E. (2022). A blend of microencapsulated organic acids and botanicals reduces necrotic enteritis via specific signaling pathways in broilers. Poultry Science, 101(4), 101753.
+ Open protocol
+ Expand
10

Brain Tissue RNA Extraction and Quantification

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Extracted brain tissue was homogenized by placing collected samples directly into 2.0 mL homogenization microtubes prefilled with 1.5 mm zirconium beads (Benchmark scientific D1032-15) and 1 mL Qiazol (RNA extraction lysate) [36 (link)]. The microtubes were then loaded onto a Bead Bug Homogenizer (Benchmark Scientific D1030) and shaken at 4000 rpm for 1 min.
The RNA was extracted and purified from homogenized tissue using RNeasy® Plus Universal Mini Kit (Qiagen 73404) at the Gene Expression and Genotyping Facility at Case Western Reserve University. RNA quality and quantity were determined using Nanodrop. Samples with low concentration were concentrated with Speedvac. Isolated RNA was stored at −80 °C for up to two months. Samples were shipped overnight on dry ice to NanoString Technologies (Seattle, WA, USA) for further quality control and quantification.
Song S., Regan B., Ereifej E.S., Chan E.R, & Capadona J.R. (2022). Neuroinflammatory Gene Expression Analysis Reveals Pathways of Interest as Potential Targets to Improve the Recording Performance of Intracortical Microelectrodes. Cells, 11(15), 2348.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!