The Institutional Animal Care and Use Committee of the University of Minnesota approved all protocols used in this study. Male C57Bl/6J mice, 7–9 weeks old, were purchased from Harlan Laboratories (Madison, WI) and housed in a vivarium with a controlled temperature (20–22°C) and light cycle (12-h light/12-h dark). Mice had free access to water and were fed a purified diet (TD.94045; Harlan Teklad, Madison, WI). One week before being sacrificed, mice received a tail vein injection of an adenovirus harboring either scramble short-hairpin RNA (shRNA), described previously (20 (link)), or shRNA targeted to Acot1 mRNA. The Acot1 shRNA adenovirus was generated from Open Biosystems (Huntsville, AL) based on accession number NM_012006.2 (antisense sequence AAACACTCACTACCCAACTGT). For the studies involving Wy-14643, mice were fed the purified diet supplemented with 0.1% Wy-14643 (Selleckchem, Houston, TX), a synthetic PPARα ligand, for 7 days (21 (link)). An additional group of mice were fed a 45% high-fat diet (HFD; TD.06415) for 12 weeks before a tail vein injection of adenoviruses. One week after transfection, all mice were fasted overnight (16 h) and sacrificed unless noted otherwise.
Wy 14643
Manufactured by Selleck Chemicals
Sourced in United States, Germany, China
Wy-14643 is a laboratory chemical compound. It serves as a selective agonist for the peroxisome proliferator-activated receptor alpha (PPARα) protein.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Td 94045, by Inotiv (1 mentions)
Cisplatin, by MedChemExpress (1 mentions)
Gw6471, by Selleck Chemicals (1 mentions)
Etomoxir, by Merck Group (1 mentions)
As1842856, by Merck Group (1 mentions)
Plus sonication chromatin ip kit, by Cell Signaling Technology (1 mentions)
Sp600125, by Selleck Chemicals (1 mentions)
Sb203580, by Selleck Chemicals (1 mentions)
Sch772984, by Selleck Chemicals (1 mentions)
Phorbol 12 myristate 13 acetate, by Merck Group (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
4 protocols using wy 14643
1
Adenoviral-Mediated Acot1 Knockdown in Mice
2
Oroxylin A and Cisplatin Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
3
Comparative Analysis of ccRCC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human ccRCC cell lines, ACHN, Caki-1, and 786-O, and normal kidney epithelial HK2 cell line were obtained from Kunming Institute of Zoology, Chinese Academy of Sciences (Kunming, China). 786O cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (HyClone, Logan, USA); ACHN, HK-2, and Caki-1 were cultured in Dulbecco’s modified Eagle medium (DMEM)/High Glucose (HyClone). Both media were supplemented with 10% fetal bovine serum (FBS; HyClone). All cells were cultured at 37°C in a 5% CO
2 incubator. Etomoxir was obtained from Sigma-Aldrich (Munich, Germany), WY14643 was from Selleck (Houston, USA), and sulfosuccinimidyl oleate (SSO) was purchased from APExBio (Houston, USA).
2 incubator. Etomoxir was obtained from Sigma-Aldrich (Munich, Germany), WY14643 was from Selleck (Houston, USA), and sulfosuccinimidyl oleate (SSO) was purchased from APExBio (Houston, USA).
4
Regulation of Inflammatory Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant human CCL2 for cell treatments was obtained from R&D (MN, USA; #279-MC-050). AS1842856 (#344355) and phorbol 12-myristate 13-acetate (PMA, #P8139) were obtained from Sigma–Aldrich (MO, USA). WY-14643 (#S8029), GW4671 (#S2798), SB203580 (#S1076), SP600125 (#S1460), and SCH772984 (S7101) were obtained from Selleck (Shanghai, China). The Dual-Luciferase Reporter Assay System (E1910) was obtained from Promega (WI, USA). The SimpleChIP (chromatin immunoprecipitation) Plus Sonication Chromatin IP Kit (#56383) and Alexa Fluor 488–conjugated CD68 antibody (#24850) were purchased from Cell Signaling Technology (MA, USA). The Alexa Fluor 647–conjugated CCR2 antibody (#ab225432) was obtained from Abcam (Cambridge, UK). The Lipofectamine 2000 (#11668019), negative control (miR-NC), miR-580-5p mimic (#4464066), and inhibitor (AM17000) were obtained from Thermo Fisher Scientific (Runcorn, Cheshire, UK). siRNA- Zinc Finger Protein 562 (ZNF562), siRNA-circ-102231, and the negative control were purchased from GenePharma Biotechnology (Shanghai, China). The siRNA target site of hsa_circ_0110102 was 5′-ACAGTGGAGAAAGGTAAATGCAA-3′, and that of ZNF562 was 5′-GTCATTGATAACATCTTATCAGG-3′. The construction of hsa_circ_0110102 overexpression in the Ubi-MCS-Luc-IRES-Puromycin vector was performed by Biosyntech Co., Ltd (Suzhou, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!