The same procedure was used to determine the IFT80 (1:400, PAB15842, Abnova), FGFR1 (1:1000, ab10646, Abcam), p-FGFR1 (1:1000, ab59194, Abcam), Smad1/5/8 (1:300, sc-6031-R, Santa Cruz), p-Smad1/5/8 (1:300, sc-12353-R, Santa Cruz), AKT (1:300, sc-8312, Santa Cruz), p-AKT (1:300, sc-7985-r, Santa Cruz).
Pab15842
PAB15842 is a piece of laboratory equipment. It is designed to perform a specific function within the laboratory setting. The core function of this product is to facilitate certain laboratory procedures or analyses, but a detailed description of its intended use or capabilities is not available at this time.
Lab products found in correlation
3 protocols using pab15842
Western Blot Analysis of Cell Signaling Proteins
The same procedure was used to determine the IFT80 (1:400, PAB15842, Abnova), FGFR1 (1:1000, ab10646, Abcam), p-FGFR1 (1:1000, ab59194, Abcam), Smad1/5/8 (1:300, sc-6031-R, Santa Cruz), p-Smad1/5/8 (1:300, sc-12353-R, Santa Cruz), AKT (1:300, sc-8312, Santa Cruz), p-AKT (1:300, sc-7985-r, Santa Cruz).
Fracture Callus RNA and Protein Analysis
List of RT-qPCR primer sequences.
Name | Forward primer sequence | Reverse primer sequence |
---|---|---|
AAGGAACCAAAGCATCAAGAATTAG | AGATGTCATCAGGCAGCTTGAC | |
AGCGACCACTTGAGCAAACAT | GCGGCTGATTGGCTTCTTCT | |
ATCTTTGGTCTGGCTCCCATG | TTTCCCGTTCACCGTCCAC | |
GCAACAGTCGCTTCACCTACA | CAATGTCCAAGGGAGCCACAT | |
GCTGCATCCATGGACAACAACA | CGAGGGCGAAATGTACTCCAGTT | |
ACTTTGTCAAGCTCATTTCC | TGCAGCGAACTTTATTGATG |
Western Blot Analysis of Signaling Proteins
The same procedure was used to determine the IFT80 (1:400, PAB15842, Abnova), AKT (1:300, sc-8312, Santa Cruz), and p-AKT (1:300, sc-7985-r, Santa Cruz).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!