Total RNA was extracted with TRIzol (#15596026, ThermoFisher) and reverse‐transcribed with the High‐Capacity cDNA Reverse Transcription Kit (#4368814, ThermoFisher). mRNA expression was determined by mixing cDNA with the following primer pairs (5′‐3′): Ormdl1 for CATAATCTGGGGATGTATGTG and rev CTTCCGAGAAGATGTAAACTG; Ormdl2 for AACAACAAGCCTGAAGTTAG and rev agcatgtagccctaattttg; Ormdl3 for TATAGTGCTGTACTTCCTCAC and rev GAATGAGCACAGTCATCAAG; TATA‐binding protein (TBP) for TTCCAAAACTCCGGGTAGGC and rev AACCGATTCCGCACAGTCTT; Tubulin, Beta 1 Class VI (Tubb) for AAGCCTACGGTAAGAAGTATG and rev CCATGAACAAAACTGTCAGG; 18 S for AGTCCCTGCCCTTTGTACACA, rev GATCCGAGGGCCTCACTAAAC and probe CGCCCGTCGCTACTACCGATTGG along with either PowerSYBR Green PCR Master Mix (#4367659, ThermoFisher) or TaqMan Universal PCR Master Mix (#4324018, ThermoFisher). cDNA was amplified and measured using a CFX Opus 96 Real‐Time PCR Detection System (#12011319, BioRad). Relative changes in gene expression were calculated using the ΔΔCt method, normalized to the geometric mean of the expression of 18 S ribosomal RNA, Tubb, and TBP.
Cfx opus 96 real time pcr detection system
Manufactured by Bio-Rad
Sourced in United States, Germany
The CFX Opus 96 Real-Time PCR Detection System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qPCR) analysis. It features a 96-well format and can detect and quantify target DNA sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (3 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (2 mentions)
Rq1 dnase, by Promega (1 mentions)
High capacity cdna reverse transcription kit, by Promega (1 mentions)
Ncbi primer blast, by Eurofins (1 mentions)
Revertaid rt kit, by Thermo Fisher Scientific (1 mentions)
Quick rna microprep kit, by Zymo Research (1 mentions)
Cfx maestro, by Bio-Rad (1 mentions)
5 protocols using cfx opus 96 real time pcr detection system
1
Quantifying Gene Expression by qRT-PCR
2
Quantifying mRNA Expression in Liver and Adipose
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from liver and adipose tissues using TRIzol (#15596026, ThermoFisher) and concentration measured with the NanoDrop 2000 (#ND2000, ThermoFisher). 2 μg was treated with RQ1 DNase (#M6101, Promega) and converted to cDNA with High-Capacity cDNA Reverse Transcription Kit (#4368814, ThermoFisher). mRNA expression was determined by mixing cDNA with the following primer pairs (5′-3′): Acta2 for GTGTGAAGAGGAAGACAGCAC and rev GTGATGATGCCGTGTTCTATCG, col1a1 for TCAGCCACCTCAAGAGAAGTC and rev CTCCGGATGTTCTCAATCTGC, or with pre made primers for Mcp1 (#qMmuCED0048300, BioRad). Products were measured with a CFX Opus 96 Real-Time PCR Detection System (#12011319, BioRad) and relative changes in gene expression were determined by ΔΔCt normalized to TATA-binding protein.
3
Quantification of Lipid and ECM Genes
4
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA from the cells stored in RNAlaterTM was extracted using a Quick-RNA Microprep Kit (R1051, Zymo Research, Freiburg, Germany), according to the manufacturer’s protocol. The RNA was eluted in 13 µL nuclease-free water, and the concentration was measured using the NanoDropTM 2000 (Thermo Scientific, Germany) by spectrophotometry. The RNA was used for cDNA synthesis using the RevertAid RT Kit (K1691, Thermo Fisher Scientific, Germany). Primers were designed using NCBI Primer-BLAST purchased from Eurofins Genomics (Ebersberg bei München, Germany). The primer list is provided in Table 1 . qPCR was performed using PerfeCTa SYBR® Green FastMix (95072, Quantabio, VWR, Darmstadt, Germany) and the CFX Opus 96 real-time PCR detection system (Bio-Rad, Feldkirchen, Germany). The input cDNA corresponded to 1 ng of total RNA, and the reaction involved an initial denaturation/activation step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 20 s and 60 °C for 50 s. A melt curve analysis was performed at the end to confirm the melting temperature of the PCR product. The cycle threshold (Ct) values were determined from the software output (CFX Maestro, Bio-Rad, Germany) and were used to calculate the fold changes in gene expression using the ΔΔCt method [43 (link)]:
5
Quantitative RT-PCR of Ormdl Genes
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!