Block it pol 2 mir rnai kit

Knockdown (KD) constructs designed to target Gadd45b mRNA were cloned using BLOCK-iT Pol II miR RNAi kit (Invitrogen). Briefly, four artificial miRNA oligonucleotides were designed using Invitrogen’s RNAi Designer (www.invitrogen.com/rnai) to KD Gadd45b and cloned into pcDNA6.2-GW. Mouse neuroblastoma (N2a) cells were transfected using lipofectamine 2000 (Invitrogen) with the different plasmids designed to target Gadd45b or LacZ as control. The level of Gadd45b mRNA KD was assessed using qRT-PCR 24 hr after transfection. The miRNA causing the most efficient downregulation was further Gateway cloned (Invitrogen) into the p1005 + HSV vector.

amiRs targeting either PRMT6 or LSD1 in mouse and human cells were designed with the online tool BLOCK-iT RNAi Designer (Supplementary Table 3). amiRs were inserted into pcDNA6.2-GW/EmGFP-miR plasmid using the BLOCK-iT Pol II miR RNAi kit (Invitrogen, #K493600) and carrying a spectinomycin resistance cassette^{107 (link)}. The expression cassette consisted of a 5′ miR flanking region, target-specific stem-loop amiR sequence, and 3′ miR flanking region. This amiR cassette can be expressed from the 3′ untranslated region of any reporter gene under the control of an RNA polymerase type II promoter^{108 (link)}. As a negative control, we used the control amiR sequence from pcDNA6.2-GW/EmGFP-miR-neg-control plasmid (provided with the kit) containing a sequence that does not target any known vertebrate gene (control amiR: AAATGTACTGCGCGTGGAGAC). Top-10 competent E. coli were transformed, and positive clones were selected using EGFP forward primer 5′-GTCCTGCTGGAGTTCGTG-3′. amiR sequences against PRMT6 (#1: TGCTGAATCAGACCATGTTGCCTTTCGTTTTGGCCACTGACTGACGAAAGGCAATGGTCTGATT) and LSD1 (#2: TGCTGTTGATGAGAGGTATACATCACGTTTTGGCCACTGACTGACGTGATGTACCTCTCATCAA) were sub-cloned downstream of EGFP under control of the CAG promoter in an AAV vector derived from pAAV-CAG-EGFP (Addgene, #37825)^{107 (link)}.