Viia7 qrt pcr system

Manufactured by Thermo Fisher Scientific

Sourced in United States

The ViiA7 qRT-PCR system is a real-time PCR instrument designed for gene expression analysis, genotyping, and other quantitative real-time PCR applications. The system features a high-performance optical detection system, precise temperature control, and intuitive software for data analysis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ViiA7 (579 citations) QRT-PCR (101 citations) ViiA7 PCR system (53 citations) QRT-PCR system (16 citations)

7 protocols using viia7 qrt pcr system

Comprehensive RT-qPCR Analysis of Adipogenic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using RNeasy plus Kit (74034, QIAGEN) together with Qiazol reagent (79306, QIAGEN). RNA purity was assessed using Nanodrop (Nanodrop, Wilmington, USA), and cDNA was synthesized using SuperScript IV VILO Master Mix (11756500, Thermo Fisher Scientific). Then, RT-qPCR was performed on ViiA7 qRT-PCR system (PE Applied Biosystems, Foster City, CA, USA), using predesigned Taqman assays following the manufacturer’s instructions. The Taqman assays (Thermo Fisher Scientific, Uppsala, Sweden) were: MTIF3 (Hs00794538_m1), GTF3A (Hs00157851_m1), ADIPOQ (Hs00977214_m1), PPARG (Hs01115513_m1), CEBPA (Hs00269972_s1), SREBF1 (Hs02561944_s1), FASN (Hs01005622_m1), TFAM (Hs01073348_g1), MT-CO1 (Hs02596864_g1), PRDM16 (Hs00223161_m1), TOMM20 (Hs03276810_g1), CPT1B (Hs00189258_m1), ACADM (Hs00936584_m1), ACAT1 (Hs00608002_m1), ABHD5 (Hs01104373_m1), PNP1A2 (Hs00386101_m1), ACACB (Hs01565914_m1), MT-ND1 (Hs02596873_s1), MT-ND2 (Hs02596874_g1), MT-ND3 (Hs02596875_s1), MT-ND4 (Hs02596876_g1), MT-CO2 (Hs02596865_g1), MT-CO3 (Hs02596866_g1), HPRT-1 (Hs99999909_m1), TBP (Hs00427620_m1), and RPL13A (Hs03043885_g1). The relative gene expression was calculated using the delta Ct method, and the target gene expression was normalized to the mean Ct of three reference genes HPRT-1, TBP, and RPL13A.

Huang M., Coral D., Ardalani H., Spegel P., Saadat A., Claussnitzer M., Mulder H., Franks P.W, & Kalamajski S. (2023). Identification of a weight loss-associated causal eQTL in MTIF3 and the effects of MTIF3 deficiency on human adipocyte function. eLife, 12, e84168.

+ Open protocol

+ Expand

Quantifying Plant microRNA Expression via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plant miRNA was detected using qRT-PCR. TaqMan MicroRNA Assays (Table 2) were purchased from Thermo Fisher Scientific (St. Louis, MO) and used for microRNA reverse transcription and detection. TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, St. Louis, MO) and the small RNA-specific RT primer from the TaqMan MicroRNA Assays were used to reverse transcribe complementary DNA. 5 μL of 2 ng/μL RNA was used in reverse transcription and 1 μL of reverse transcription product was used in qRT-PCR. PCR was performed on ViiA7 qRT-PCR System (Applied Biosystems, Foster City, CA) using TaqMan Universal PCR Master Mix (Cat No.: 4304437) and small RNA-specific TaqMan primer from the TaqMan MicroRNA Assays. The following amplification parameters were used for PCR: 50°C for 2 min, 95°C for 10 min, and 40 cycles of amplification at 95°C for 15 sec and 60°C for 1 min.

Huang H., Roh J., Davis C.D, & Wang T.T. (2017). An improved method to quantitate mature plant microRNA in biological matrices using modified periodate treatment and inclusion of internal controls. PLoS ONE, 12(4), e0175429.

+ Open protocol

+ Expand

Comprehensive Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Jejunum mucosa and colon tissue were homogenized using a Bullet Blender (Next Advance, Inc., Troy, NY) and the manufacturer’s recommendation for RINO tubes, speed and duration (pink screw cap tubes for 3 minutes on power 8, PINKR5-RNA; or green screw cap tubes for 3 minutes on power 12, GREENR5-RNA) and buffers from the Qiagen AllPrep DNA/RNA mini kit (Qiagen, cat# 80204, Germantown, MD). DNA and RNA were extracted from the homogenized samples following the manufacturer’s protocol. Total RNA was measured using a NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA). RNA was then reverse transcribed with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, cat# 4368813, Thermo Fisher) according to the manufacturer’s protocol. We then used custom TaqMan 384-target arrays (targets listed in Table S1; select genes for colon expression listed in Table S2), TaqMan Fast Advanced Gene Expression Master Mix (Applied Biosystems, cat# 4444557) or SYBR Select Master Mix (colon genes, Applied Biosystems, cat# 4472908) and a Viia 7 qRT-PCR System (Applied Biosystems) to amplify cDNA. Expression levels were normalized to Ywhaz using the 2^−ΔΔCt method and then expressed as difference from average of control.

Ewing L.E., Miousse I.R., Pathak R., Skinner C.M., Boerma M., Hauer-Jensen M, & Koturbash I. (2019). NZO/HlLtJ as a novel model for the studies on the role of metabolic syndrome in acute radiation toxicity. International journal of radiation biology, 96(1), 93-99.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of CCND1

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized using the SuperScript IV Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) with 1 μg of the total RNA input for confirmation of the RNA-seq results. Quantitative Real time PCR (qRT-PCR) analysis using SYBRGreen (BioRad, Hercules, CA, USA) was performed to determine relative gene expression using the ViiA 7 qRT-PCR System (Applied Biosystems, Foster City, CA, USA). RPL17 was used as a reference gene for data normalization. Primer sequences used for qRT-PCR (5′-3′) were as follows; RPL17 forward (ACGAAAAGCCACGAAGTATCTG), RPL17 reverse (GACCTTGTGTCCAGCCCCAT), CCND1 forward (AGCTCCTGTGCTGCGAAGTGGAAAC), CCND1 reverse (AGTGTTCAATGAAATCGTGCGGGGT).

Paul E.N., Burns G.W., Carpenter T.J., Grey J.A., Fazleabas A.T, & Teixeira J.M. (2021). Transcriptome Analyses of Myometrium from Fibroid Patients Reveals Phenotypic Differences Compared to Non-Diseased Myometrium. International Journal of Molecular Sciences, 22(7), 3618.

+ Open protocol

+ Expand

Quantifying Gene Expression in Cardiac Ventricles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from ventricles using Trizol (Invitrogen) and DNase treated using TURBO DNA-free DNase Treatment Kit (Ambion). First-strand cDNA was synthesized using a high Capacity cDNA Reverse Transcription kit (Applied Biosystems). Gene expression was assayed using the Power SYBR Green PCR Master Mix (Applied Biosystems) with primers listed below and quantified using the StepOne Plus Real-Time PCR system or ViiA™ 7 qRT-PCR system (Applied Biosystems). Relative fold changes were calculated using the comparative threshold cycle methods (2-ΔΔCt).
qRT-PCR oligonucleotide sequences

Li G., Khandekar A., Yin T., Hicks S.C., Guo Q., Takahashi K., Lipovsky C.E., Brumback B.D., Rao P.K., Weinheimer C.J, & Rentschler S.L. (2018). Differential Wnt-Mediated Programming and Arrhythmogenesis in Right versus Left Ventricles. Journal of molecular and cellular cardiology, 123, 92-107.

+ Open protocol

+ Expand

Quantifying Mitochondrial Biogenesis in White Adipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

To examine the effects of MTIF3 knockout on mitochondrial biogenesis in white adipocytes, relative amount of mtDNA was quantified using a qPCR-based method described previously (Ajaz et al., 2015 (link)). Briefly, total DNA was extracted and quantified using QIAamp DNA Mini Kit (catalogue number: 56304, QIAGEN) from scrambled control and MTIF3 knockout cells. For qPCR, equal amounts of total DNA from each sample were mixed with SYBR Green master mix (catalogue number: A25742, Thermo Fisher Scientific) and with primers targeting mitochondrial and nuclear genes, then the samples were run on ViiA7 qRT-PCR system (PE Applied Biosystems, Foster City, CA, USA). The relative mtDNA content was calculated as ΔCt (Ct of nuclear target − Ct of mitochondrial target).

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted with TRIzol reagent (Invitrogen Life Technology) following the manufacturer’s instruction. RNA (1 μg) was then reverse-transcribed to cDNA using M-MLV reverse transcriptase according to the manufacturer’s instructions (Takara). Quantitative real-time PCR (qRT-PCR) analysis was performed using FastSYBR Mixture with ROX (Cwbiotech) on the ViiA™7 qRT-PCR System (Applied Biosystems). Gene-specific primers for GAPDH, COX-1, COX-2, and ORF7 were listed in Table 4.

Du L., Wang H., Liu F., Wei Z., Weng C., Tang J, & Feng W.H. (2021). NSP2 Is Important for Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus to Trigger High Fever-Related COX-2-PGE2 Pathway in Pigs. Frontiers in Immunology, 12, 657071.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!