The protein kinase inhibitors Torin 1, rapamycin, LY2090314, and CHIR99021 were purchased from Selleckchem (Houston, Texas, USA), whereas PTEN (sc-29459) and negative control (sc-37007) siRNAs were from Santa Cruz Biotechnology, Inc. (Dallas, Tex.). All other chemicals were purchased from Sigma-Aldrich (Oakville, Ontario, Canada). The LUC reporter plasmid MT1-LUC contains 1843 bp of the 5= flanking region and 68 bp of the 5= untranslated region from the mouse Mt1 gene (Faraonio et al. 2000) (link). Similarly, the plasmid MT2A-LUC contains a human Mt2A gene DNA fragment (positions -780 to +65) cloned into pGL2 basic (Promega, Madison, Wisconsin, USA) (Dubé et al. 2011 (link)). To construct plasmid (MREd) 6 -LUC, a synthetic DNA fragment containing 6 mouse Mt1 MREd elements (Labbé et al. 1991) (link) (5 elements in direct tandem orientation and the 6th in the opposite orientation) was cloned in front of a minimal mouse Mt1 promoter DNA fragment (positions -35 to -68) into the LUC reporter plasmid pGL2-Basic (Promega, Madison, Wis.). TOP-Flash and FOP-Flash plasmids were purchased from Upstate (Temecula, California, USA).
Pgl2 basic
Manufactured by Promega
Sourced in United States
The PGL2-Basic is a plasmid vector designed for gene expression studies in mammalian cells. It contains a multiple cloning site for the insertion of target genes, as well as elements necessary for replication and selection in both bacterial and mammalian cells.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Merck Group (3 mentions)
Metafectene pro, by Biontex (2 mentions)
Pcl eco retrovirus packaging vector, by Novus Biologicals (2 mentions)
Dual luciferase reporter assay system, by Promega (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
X tremegene hp dna transfection reagent, by Roche (2 mentions)
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Pgl2 promoter, by Promega (1 mentions)
Dual luciferase assay system, by Promega (1 mentions)
Affi gel 10, by Bio-Rad (1 mentions)
Endofree maxiprep kit, by Qiagen (1 mentions)
Recombinant human tnf α, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Promega (1 mentions)
γ tubulin, by Merck Group (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
Gibco dmem, by Thermo Fisher Scientific (1 mentions)
Dual glo luciferase reporter assay system, by Promega (1 mentions)
Cytation 3 cell imaging multi mode reader, by Agilent Technologies (1 mentions)
33 protocols using pgl2 basic
1
Transcriptional Reporter Plasmid Construction
2
Comparative Luciferase Assay for Genetic Sequences
3
Comparative Luciferase Assay for Genetic Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences of interest were cloned from mouse genomic DNA and human DNA derived from risk and non-risk allele carriers into the pGL2basic (Promega) or pFOX (Raum et al., 2010 (link)) luciferase vector as indicated (primer sequences are presented in Table S2 and the location of the control sequences is indicated in Figures 4C , S4I, and S4J ). Luciferase reporter assays were performed in HEK293 or β-TC6 cells as described (Mazur et al., 2013 (link)). Exogenous MafA protein was overexpressed using a pCMV MafA construct. Transient transfection of all plasmids was performed using Metafectene Pro (Biontex Laboratories). Empty vector transfections were used as controls where indicated. The data are mean expression with SEM and were analyzed with ANOVA and Tukey multiple comparison tests.
4
Plasmid Constructs for Hepatitis Virus Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids pCMV-3 × HA1-HBx [12 (link)] and pCMV-3 × HA1-core protein [13 (link)] encode the full-length HBx (genotype C) and HCV core protein (genotype 1b), respectively, downstream of three copies of the influenza virus hemagglutinin (HA) epitope. The E-cad-luc, containing the promoter region of E-cadherin in pGL2-Basic (Promega, Cat No. E1641) was described before [14 (link)]. The HBV replicon (1.2-mer WT), containing 1.2 units of the HBV genome (genotype D) [15 (link)], and pJFH-1, containing HCV cDNA from a Japanese patient with fulminant hepatitis [16 (link)], were described previously. The p53 expression plasmid, pCMV p53-WT, was kindly provided by Dr. C.-W. Lee (Sungkyunkwan University). Scrambled (SC) shRNA (Cat No. sc-37007) and p53 shRNA plasmids (sc-29435-SH and sc-44218-SH) were purchased from Santa Cruz Biotechnology. Plasmids RC210241 (Cat No. 003049) encoding the Myc-DDK-tagged human Na+-taurocholate cotransporting polypeptide (NTCP) and pCH110 (Cat No. 27-4508-01) encoding the Escherichia coli β-galactosidase (β-gal) gene under the control of the SV40 promoter were purchased from OriGene and Amersham, respectively.
5
Evaluating ATRX Promoter Activity with JMJD1A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human ATRX promoter spanning from −600 to +100 (the ATRX transcription start site was based on the human transcript variant 1: NCBI reference sequence NM_000489.4) was cloned into pGL2-Basic (Promega Corp., Madison, WI, USA). Human 293T and HCT116 cells, which were grown in 12-wells, were transiently transfected with 100 ng of this luciferase reporter construct, 900 ng pBluescript KS+, and 60 ng of Flag-JMJD1A expression plasmid or empty vector pEV3S utilizing 2 µg polyethylenimine (43 (link)). Approximately 42 h after transfection, cells were lysed as described (46 (link)) and luciferase activities determined in a luminometer (47 (link)).
6
Murine Mast Cell Line Characterization and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Murine mast cell lines FMP6- and MST have been described (McKinlay et al, 1998 (link)) (Elefanty & Cory, 1992 (link)) and characterised (Bockamp et al, 1998 (link)) previously. Cx3cr1 luciferase reporter constructs were custom-made (Life Technologies), cloned into pGL2basic (Promega) and confirmed by sequencing. Cells were transfected and assayed as previously described (Gottgens et al, 1997 (link)).
shRNA fragments were inserted into pMSCV/LTRmiR30-PIG: luciferase (5′ CACGTACGCGGAATACTTCGAA 3′ (Bot et al, 2005 (link))), Erg (5′ ACCTCCCAATATGACCACAAAT 3′), Gata2 (5′ CGCCGCCATTACTGTGAATATT 3′ (Huang et al, 2009 (link))), Fli1 (5′ ACCAGTGAGAGTCAATGTCAAG 3′), Pu.1 (5′ AGGATGTGCTTCCCTTATCAAA 3′) and Lmo2 (5′ CCCAGCCCTTAGAGAGAATTTA 3′). Retrovirus was produced using the pCL-Eco Retrovirus Packaging Vector (Imgenex). BMMCs were infected with retrovirus by centrifugation at 2,200 rpm at 32°C for 1.5 h with 4 μg/ml polybrene (Sigma-Aldrich) after which the retroviral supernatant was replaced with fresh media. After 48 h, GFP+-transduced cells were sorted and cultured further for 24 h before RNA extraction. Knock-down efficiency is shown in Supplementary Fig S8A.
shRNA fragments were inserted into pMSCV/LTRmiR30-PIG: luciferase (5′ CACGTACGCGGAATACTTCGAA 3′ (Bot et al, 2005 (link))), Erg (5′ ACCTCCCAATATGACCACAAAT 3′), Gata2 (5′ CGCCGCCATTACTGTGAATATT 3′ (Huang et al, 2009 (link))), Fli1 (5′ ACCAGTGAGAGTCAATGTCAAG 3′), Pu.1 (5′ AGGATGTGCTTCCCTTATCAAA 3′) and Lmo2 (5′ CCCAGCCCTTAGAGAGAATTTA 3′). Retrovirus was produced using the pCL-Eco Retrovirus Packaging Vector (Imgenex). BMMCs were infected with retrovirus by centrifugation at 2,200 rpm at 32°C for 1.5 h with 4 μg/ml polybrene (Sigma-Aldrich) after which the retroviral supernatant was replaced with fresh media. After 48 h, GFP+-transduced cells were sorted and cultured further for 24 h before RNA extraction. Knock-down efficiency is shown in Supplementary Fig S8A.
7
Constructing Hypoxia Response Element Reporters
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct the WWTR1-HRE and SIAH1-HRE reporters, 55-bp double-stranded oligonucleotides were inserted between the BamHI and SalI sites of pGL2-Promoter (Promega). All plasmid constructs were confirmed by nucleotide sequence analysis. A 247-bp CTGF promoter sequence was amplified from human genomic DNA by PCR (primers: 5′-CCCCTCGAGAGTGTGCCAGCTTTTTCAGAC-3′ and 5′-CGAAGCTTCGAGCTGGAGGGTGGAGT-3′), purified by gel extraction, and inserted into the XhoI and HindIII sites of pGL2-Basic (Promega). For HRE reporter assays [48 (link)], cells were seeded onto 48-well plates and co-transfected with recombinant pGL2-Promoter plasmid, which contained HRE-WT or HRE-MUT sequences, and pSV-Renilla. Transfected cells were exposed to 20% or 1% O2 for 24 h. Firefly luciferase and Renilla luciferase activities in cell lysates were determined using the Dual-Luciferase Assay System (Promega).
8
Survivin Promoter-Driven Luciferase Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct luciferase expression plasmid under the control of survivin promoter (pSurvivin-Luc), a 977 bp fragment of the human survivin gene promoter was generated (nucleotides 1824–2800, GenBank Accession Number U75285) by PCR reaction from the A549 genomic DNA. The oligonucleotide primers used were as follows: forward primer 5′-ATA CGA GAT CTGG CCA TAG AAC CA-3′ and reverse primer 5′-ATG TAA AGC TTC CAC CTC TGC CA-3′. After the digestion and purification of restriction enzymes, the fragment was inserted into the luciferase vector pGL2-basic (Promega, Madison, WI) between the XhoI and HindIII sites. For an empty experimental control plasmid (pGL2-basic-CD), we used a promoter-less pGL2-basic vector in which the luciferase gene was replaced with the survivin promoter gene. These plasmids were confirmed by sequence analysis.
9
Murine Itm2a Gene Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An approximately 2 kb genomic fragment containing +28 to -1964 in relation to the transcriptional start site of the murine Itm2a gene was amplified and cloned into the BglII site of the PGL2-Basic (Promega) to create Itm2a-Luc. The IL-13-Luc and pcDNA3-GATA3 were previous reported [25] (link). In all luciferase assays, murine M12 B cells were transfected with 10 µg of luciferase reporter, 5 µg of pcDNA3 vector, and 5 µg pTK-Renilla with BIORAD GENE PULSER II set at 280 V and 0.975 F. Luciferase activity was determined in duplicate with Dual-Luciferase Reporter Assay System (Promega, Madison, WI). The firefly luciferase activity obtained from each sample was normalized against the renilla luciferase activity from the same sample.
10
Cloning and Characterization of Zbtb7c
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pcDNA3.0-FLAG-Zbtb7c and pcDNA3.1-Zbtb7c constructs were prepared by cloning full-length cDNA into pcDNA3.0 or pcDNA3.1 (Invitrogen, CA). The pGL2-SIRT1-Luc human SIRT1 promoter-luciferase reporter gene fusion construct was generated by cloning SIRT1 promoter DNA (−1250 ~ +79 bp) into pGL2-Basic (Promega, WI). The pcDNA3-p53, pcDNA3-Sp1, and corepressor expression vectors have been reported elsewhere4 (link),5 (link). All plasmid constructs were verified by DNA sequencing. Descriptions of the recombinant adenovirus shRNA and siRNA against Zbtb7c mRNA have been reported elsewhere18 (link),21 (link). Antibodies against p53, p300, SIRT1, AMPK, phosphorylated APMK, PGC-1, PPARγ, Zbtb7c, acetylated lysine, GAPDH, FLAG-Tag, Myc-Tag, Ac-H3, Ac-H4, and mSin3A were purchased from Upstate (Charlottesville, VA), Chemicon (Temecula, CA), Cell Signaling Technology (Beverly, MA), Calbiochem (San Diego, CA), and Santa Cruz Biotech (Santa Cruz, CA). A rabbit polyclonal antibody against Zbtb7c was prepared in-house using recombinant GST-POZ (a.a. 1–120) and purified using Affi-Gel 10 (Bio-Rad, CA). Most of the chemical reagents were purchased from Sigma (St. Louis, MO).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!