WM1366 melanoma cells were harvested by trypsinization. Cells were resuspended in ice-cold co-IP buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 1% Na-deoxycholate, 0.05% SDS, and protease inhibitor) and lysed by mild sonication (three 5-s pulses). The cell debris were removed by centrifugation, and the supernatant was subjected to extensive DNase I digestion. Co-IP was performed by incubating 500 µg of the lysate with 4 µg of anti-AR (5153S; CST) or anti-RNA pol II (ab26721; Abcam) antibodies in 500 µl co-IP buffer for 8 h at 4°C. A mock reaction was also performed by incubating rabbit IgG (as control) with the lysate. Prewashed Protein A magnetic beads were added, and the incubation was continued for another 1 h. The beads were washed three times with 1 ml of co-IP buffer, resuspended in SDS-PAGE sample loading buffer, and incubated for 20 min at 98°C. The samples were resolved on 8% SDS-PAGE, and immunoblotting was performed with anti-AR (06-680; Merck Millipore), anti-RNA pol II (ab26721; Abcam), and anti-Ku70 (GTX101820; GeneTex) antibodies. VeriBlot IP Detection Reagent (HRP; ab131366; Abcam) was used as secondary antibody (1:200 dilution) to selectively detect target protein bands, without interference from the denatured IgG heavy and light chains. Details of the antibodies used are provided in Table S6 .
Ab26721
Manufactured by Abcam
Sourced in United States, United Kingdom
Ab26721 is a lab equipment product offered by Abcam. It is a piece of laboratory equipment designed for use in scientific research and analysis. The core function of this product is to [description unavailable].
Automatically generated - may contain errors
Lab products found in correlation
Ab5095, by Abcam (3 mentions)
Ab5131, by Abcam (3 mentions)
Protein g magnetic beads, by Thermo Fisher Scientific (2 mentions)
Ab131366, by Abcam (1 mentions)
Veriblot ip detection reagent, by Abcam (1 mentions)
Ab8895, by Abcam (1 mentions)
Ab992, by Abcam (1 mentions)
Ab70303, by Abcam (1 mentions)
Ab9050, by Abcam (1 mentions)
Ab31387, by Abcam (1 mentions)
Sc 352x, by Santa Cruz Biotechnology (1 mentions)
Gtx35035, by GeneTex (1 mentions)
Ab70774, by Abcam (1 mentions)
Ab76025, by Abcam (1 mentions)
Sc 133217, by Santa Cruz Biotechnology (1 mentions)
Ta811000, by OriGene (1 mentions)
C15410003, by Diagenode (1 mentions)
A8592, by Merck Group (1 mentions)
Ab172730, by Abcam (1 mentions)
Anti gdf3, by R&D Systems (1 mentions)
8 protocols using ab26721
1
Immunoprecipitation of Androgen Receptor
2
ChIP-qPCR for Histone Modifications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed as described before.26 (link) In brief, cells were fixed in 0.8% formaldehyde for 6 min at room temperature. Sonicated chromatin was immunoprecipitated with antibodies for H3K4me1 (ab8895; Abcam, Cambridge, MA, USA), H3K36me3 (ab9050; Abcam), RNA polymerase II CTD (ab26721; Abcam), Rad21 (ab992; Abcam), PU.1 (sc-352X; Santa Cruz), CREB (ab31387; Abcam), Hoxa9 (sc-17155X; Santa Cruz Biotechnology, Santa Cruz, CA, USA), CTCF (ab70303; Abcam), or rabbit IgG (15006; Sigma-Aldrich). A 10% aliquot was removed as an input fraction. Quantitative real-time PCR was performed with ChIP DNA and input DNA using a Light Cycler 480II. Relative quantitation was carried out by the comparative threshold cycle (CT) method. Statistical analysis was performed using the GraphPad Prism 5 software. The Student's t-test was used on measurements of enrichment from different condition samples from three experimental replicates. Primers for ChIP-qPCR are shown in Table 1 .
3
ChIP Assays for Epigenetic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays for CTCF, RNAP II, H3K4me3, and H3K9me3 were performed using 3 × 106 B95-8 cells, SNU719 cells, and BART(+/-)·S13 (BART(+)·S13+, Mt BART(+)·S13-, BART(-)·S13+, Mt BART(-)·S13-) HEK293-EBV cells per sample, according to the crosslinking chromatin immunoprecipitation (X-ChIP) protocol provided by Abcam (Cambridge, UK) with a slight modification. Before crosslinking, we induced EBV lytic reactivation by treating these cells with TPA (20 ng/mL) and NaB (3 mM) for 48 h. According to the manufacturer’s protocol, a Bioruptor (BMS, Korea) was used to sonicate the genomic DNA. Sonicated cell lysates were subjected to immunoprecipitation with antibodies against CTCF (07–729, Millipore), RNAPII (ab26721, Abcam), H3K4me3 (07–442, Millipore), H3K9me3 (07–472, Millipore), and normal rabbit IgG (GTX35035, Genetex). The precipitates were incubated with ChIP elution buffer (1% SDS, 100 mM NaHCO3); next, samples were reverse-crosslinked at 65°C overnight and purified using Promega columns. Purified DNA was analyzed using RT-qPCR. ChIP DNA values were calculated as a proportional expression over isotype-specific input DNA values of each primer set.
4
Antibody Usage in Protein Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antibodies were used for immunoblotting and immunoprecipitation: polyclonal anti-ZC3H4 antibody, developed against a purified GST-tagged human ZC3H4 fragment (amino acid residues 1114–1315) in this study; polyclonal anti-WDR82 antibody (kindly provided by the Roeder laboratory); anti-CK2α (10992-1-AP, Proteintech); anti-CK2β (ab76025, Abcam); anti-SPT5 (A300-869A for immunoblotting; A300-868A for immunoprecipitation, Bethyl Laboratories); anti-RNAPII (ab26721, Abcam); anti-S5p RNAPII (ab5131, Abcam); anti-S2p RNAPII (ab5095, Abcam); anti-β-actin (TA811000, Origene); anti-phospho-CK2 substrate [(pS/pT)DXE] (8738, Cell Signaling Technology) and anti-FLAG (A8592, Sigma-Aldrich). The following antibodies were used for ChIP-seq analyses: anti-ZC3H4 (this study) and anti-WDR82 (48 (link)), generated in house; anti-CK2α (ab70774, Abcam); anti-SPT5 (sc-133217, Santa Cruz); anti-RNAPII (A300-653A, Bethyl Laboratories); anti-S5p RNAPII (ab5131, Abcam); anti-Sp2 RNAPII (A300-654A, Bethyl Laboratories); anti-H3K4me3 (C15410003, Diagenode); anti-H3K27me3 (9733, Cell Signaling Technology) and anti-H3K36me3 (61101, Active Motif).
5
ChIP-qPCR Analysis of RNA Pol II Binding on VEGF Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were resuspended with PBS and sonicated by adding ChIP nuclear lysis buffer to obtain the ideal chromatin fragments with a length of 150–1000 bp for IP reactions. The fragments were treated overnight with magnetic beads and antibody (anti-RNA Pol II, 5:25, ab26721, Abcam) followed by de-crosslinking. Purified DNA was obtained using a DNA purification kit (TIANGEN, DP214-02, Biolink Biotechnology, Beijing, China). Subsequently, quantitative polymerase-chain reaction (PCR) was performed to assess the enrichment level of RNA Pol II at the binding sites of the VEGF promoter, with total chromatin as standard changes (input). Rabbit IgG antibody (ab172730, Abcam) was used as the negative reference, and primers for the VEGF promoter region were designed: VEGF-F 5’-3’: GACGTTCCTTAGTGCTGGCGGGTAGGTTTGA; VEGF-R 5’-3’: GGCACCAAGTTTGTGGAGCTGAGAAC. Reaction conditions were as follows: pre-denaturation at 95°C for 3 min, 40 cycles of denaturation at 95°C for 10s, annealing at 55°C for 30s, and extension at 62°C for 20s. The PCR products were subjected to electrophoresis on 1% Tris-acetate-ethylenediamine tetraacetic acid agarose gels in triplicate [53 (link),54 (link)].
6
Antibody Validation for Immunoblotting and ChIP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies for immunoblotting were as follows: anti-β-actin (sc-47778, Santa Cruz); anti-β-Tubulin (T8328, Sigma-Aldrich); anti-AKT (9272, Cell Signaling Technology); anti-p-AKT (4051, Cell Signaling Technology); anti-Gdf3 (AF958, R&D Systems); anti-ATGL (sc-8020, Santa Cruz); anti-C/EBPα (sc-365318, Santa Cruz); and anti-PPARγ (sc-7273, Santa Cruz). Antibodies for ChIP were as follows: anti-Brd4 (A301-985A, Bethyl Laboratories Inc); anti-PPARγ (ab41928, Abcam); and anti-RNA polymerase II (ab26721, Abcam). Antibodies for FACS flow cytometry were as follows: anti-mouse CD45.2 PerCP-Cyanine5.5 (45-0454, eBioscience); anti-mouse F4/80 antigen PE (12-4801, eBioscience); anti-mouse CD11b APC-eFluor 780 (47-0112, eBioscience); anti-mouse CD11c Brilliant Violet 60 (117334, BioLegend); and anti-Mouse CD301Alexa Fluor 647 (MCA2392A647, Bio-Rad).
7
Co-IP of CTD-Phosphorylated Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Co-IP was carried out according to the previous study (Li et al., 2018) , except that nuclear protein extracts were used in this study. Siliques at 4 DAP were ground in liquid nitrogen and lysed with nuclear fractionation buffer (20-mM Tris-HCl pH 7.0, 250-mM sucrose, 25% [v/v] glycerol, 20-mM KCl, 2-mM EDTA, 2.5-mM MgCl 2 , 30-mM β-mercaptoethanol, protease inhibitor cocktail, and 0.7% [v/v] Triton X-100) for 15 min on ice. After the obtained slurry was filtered on a 100-μm cell strainer to remove tissue debris, the total filtrate was centrifuged at 1,000 g for 5 min at 4°C. The pellet was washed with resuspension buffer (20-mM Tris-HCl pH 7.0, 20-mM KCl, 2-mM EDTA, 2.5-mM MgCl 2 , 30-mM β-mercaptoethanol, and protease inhibitor cocktail) 3-4 times, resuspended in extraction buffer (50-mM Tris-HCl pH 7.5, 150-mM NaCl, 1-mM EDTA, 5% [v/v] glycerol, 0.5% [v/v] Triton X-100, 1-mM PMSF, proteinase inhibitor cocktail, and 25-μM MG132), incubated with protein G magnetic beads (Thermo Fisher Scientific) supplied with anti-CTD (ab26721; Abcam), anti-CTD (S2P) (ab5095; Abcam), or anti-CTD (S5P) (ab5131; Abcam) antibodies at 4°C for 2 h, and then washed 4-6 times in extraction buffer. Immunoprecipitated proteins and nuclear protein extracts as the input were resolved by SDSpolyacrylamide gel electrophoresis and detected by various antibodies.
8
ChIP-seq Analysis of RNA Pol II
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assay was performed following the reported protocol with minor modifications (Kaufmann et al., 2010; Li et al., 2018) . The extracted chromatin was sonicated to produce DNA fragments of 200-500 bp and incubated with anti-FLAG beads (Sigma) or Protein G magnetic beads (Thermo Fisher Scientific) supplied with anti-CTD (ab26721; Abcam, Cambridge, UK), anti-CTD (S2P) (ab5095; Abcam), or anti-CTD (S5P) (ab5131; Abcam) antibodies for 2 h at 4°C. A genomic fragment of TUBULIN2 (TUB2) was amplified as a control. Foldenrichment was calculated first by normalizing the amount of a target DNA fragment in the immunoprecipitated fraction against that in the input and then by normalizing the value of this fragment against that for TUB2 as a negative control. ChIP assays were repeated with three biological replicates. The primers used are listed in Supplemental Data Set 2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!