Northern max gly kit

A single colony from each mutant was inoculated in 5 ml of YEPD
overnight at 24 °C. A 5 μl aliquot of each culture was inoculated
into 25 ml of fresh YEPD and grown for an additional 2 days at 24 °C. A 5
ml aliquot of each culture was pelleted, and RNA was extracted using the
MasterPure Yeast RNA Purification Kit (Lucigen cat# MPY03100). RNA samples mixed
with glyoxal loading dye were separated on a 1% agarose gel and transferred to
nitrocellulose membrane using the NorthernMax-Gly Kit (Invitrogen cat# AM1946).
The P³²- labeled DNA probes were made by randomly primed DNA
synthesis. Ty1 PvuII-SnaBI fragment of Ty1-H3
was used as a P³²-labeled DNA probe and was prepared as described
above. The control PYK1 probe was prepared by PCR using two primers PYK1-F1
(GTTGTTGCTGGTTCTGACTTGAGAA) and PYK1-R1 (TCAAGATACCGAATTCCTTAGCC). The intensity
of bands on Southern blots corresponding to Ty RNA fragments was analyzed with
ImageQuant TL and normalized to the PYK1 RNA signal.

RT-PCR (Reverse transcription-PCR) and real-time PCR were performed as previously described^{32 (link)}. mRNA was prepared using the RNeasy Plus kit (Qiagen) and reverse-transcribed using the First Strand Synthesis kit (Invitrogen). Northern blotting and hybridization were performed using Northern Max-Gly Kit (Invitrogen) following manufacture instructions. 20 μg total RNA were used for each lane. Quantitative real-time RT-PCR (qRT-PCR) was performed on the ABI 7500-FAST Sequence Detection System using the Power SYBR Green PCR Master Mix (Applied Biosystems). Gene expressions were calculated following normalization to GAPDH levels using the comparative Ct (Cycle threshold) method. Primer sequences are available upon request.
RNA-seq samples were sequenced using the Illumina Hiseq 2000, and raw reads were mapped to human reference genome (hg18) and transcriptome using the RNA-Seq unified mapper^{47 (link)}. The reads per kilobase per million (RPKM) expression levels of BS69KD and control were compared using EdgeR. Genes with RPKM < 5 in both the KD and control samples were removed. Genes with a fold change ≥1.5 were selected as differential genes. Gene Ontology analysis was performed using the DAVID Bioinformatics Resource 6.7^{48 (link)}.