Frozen 10-μm tissue sections were fixed with 70% ethanol for 10 min and stained with Kernechtrot (Merck, Darmstadt, Germany). A total of ~1,000 carcinoma cells in the frozen sections were punched out using a LCM system (LM100; Olympus Corporation, Tokyo, Japan) and collected on a plastic cap (CapSureTM LCM Caps; Arcturus, Mountain View, CA, USA). All specimens were assessed histologically by a pathologist (Professor E. Kawahara).
Lm100
Manufactured by Olympus
Sourced in Japan
The LM100 is a compact and versatile laboratory microscope designed for a range of applications. It features a high-quality optical system and sturdy construction to provide reliable performance. The LM100 is suitable for various educational and research purposes where a basic microscope is required.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using lm100
1
Laser Capture Microdissection of Carcinoma Cells
2
Detection of K-ras Mutations in Pancreatic Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue specimens of pancreas ductal complexes and adenocarcinomas were harvested using a laser capture microdissection system, LM100 (Olympus Corporation, Tokyo, Japan), in a microdissection manner, followed by DNA extraction with DNeasy Tissue Kit (QIAGEN, Valencia, CA). According to the method described by Levi et al. et al. [9] , the detection of point mutations on K-ras in these specimens was performed by 2-step PCR-restriction enzyme fragment length polymorphism (RFLP). In brief, DNA samples underwent the rst PCR reaction using 5'actgagtataaacttgtggtagttggacctg3' (sense) 5'cagcatttacctctatcgtaggatc3' (antisense) as primers then digested with Mval, restriction enzyme. The subsequent second PCR reaction using 5'acttgtggtagttggaggtg3' (sense) and 5'attcagaatcactttgtgga3' (antisense), digestion was performed on the samples, followed by treatment with HphI, restriction enzyme. Finally, RFLP analysis was conducted on polyacrylamide gels, 15/25 (Daiichi pure chemical, Tokyo, Japan).
3
Detection of K-ras Mutations in Pancreatic Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue specimens of pancreas ductal complexes and adenocarcinomas were harvested using a laser capture microdissection system, LM100 (Olympus Corporation, Tokyo, Japan), in a microdissection manner, followed by DNA extraction with DNeasy Tissue Kit (QIAGEN, Valencia, CA). According to the method described by Levi et al. et al. [9] , the detection of point mutations on K-ras in these specimens was performed by 2-step PCR-restriction enzyme fragment length polymorphism (RFLP). In brief, DNA samples underwent the rst PCR reaction using 5'actgagtataaacttgtggtagttggacctg3' (sense) 5'cagcatttacctctatcgtaggatc3' (antisense) as primers then digested with Mval, restriction enzyme. The subsequent second PCR reaction using 5'acttgtggtagttggaggtg3' (sense) and 5'attcagaatcactttgtgga3' (antisense), digestion was performed on the samples, followed by treatment with HphI, restriction enzyme. Finally, RFLP analysis was conducted on polyacrylamide gels, 15/25 (Daiichi pure chemical, Tokyo, Japan).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!