Total RNA was isolated from cells using TRIzol reagent (Invitrogen, USA). For mRNA and lncRNA quantification, the RNA was reverse transcribed into cDNA with a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA). EvaGreen 2× qRT-PCR MasterMix-Low ROX (abm, Canada) was used for quantitation with specific primers for the mRNA and lncRNA. GAPDH was used as an internal control. For miRNA quantification, reverse transcription was performed using an miRNA First Strand cDNA Synthesis (Stem-loop Method) Kit (Sangon Biotech, Shanghai, China). A MicroRNA qRT-PCR Kit (SYBR Green Method) (Sangon Biotech, Shanghai, China) was used for quantitation with specific primers for miRNA, and U6 was used as an internal control. The primer sequences were listed in Table S1 . All quantitative real-time PCR experiments were performed with an Agilent Technologies Stratagene Mx3000P system (Agilent Technologies, USA). The data was processed with the 2-ΔΔCt method, and the fold changes were normalized to the expression of the internal controls.
Evagreen 2 qrt pcr mastermix low rox
Manufactured by Applied Biological Materials
Sourced in Canada
EvaGreen 2× qRT-PCR MasterMix-Low ROX is a ready-to-use solution for quantitative reverse transcription PCR (qRT-PCR) applications. It contains EvaGreen dye, a fluorescent DNA-binding dye, and a low-ROX reference dye.
Automatically generated - may contain errors
Lab products found in correlation
Stratagene mx3000p system, by Agilent Technologies (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Mirna first strand cdna synthesis kit stem loop method, by Sangon (1 mentions)
Microrna qrt pcr kit sybr green method, by Sangon (1 mentions)
2 protocols using evagreen 2 qrt pcr mastermix low rox
1
Quantitative Analysis of RNA Expression
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using TRIzol reagent (Invitrogen, US) according to the manufacturer’s instructions. mRNA was quantified and then reverse transcribed into cDNA using the 5 × All-In-One RT MasterMix cDNA Synthesis Kit (abm, Canada). EvaGreen 2 × qRT-PCR MasterMix-Low ROX (abm, Canada) was used to quantify fluorescence with specific primers for the mRNA. GAPDH was used as an internal control. All qRT-PCR experiments were performed using the Agilent Technologies Stratagene Mx3000P system (Agilent Technologies, Palo Alto, CA, USA). The data were processed with the 2−ΔΔCt method, and the fold changes were normalized to the expression of the internal controls. The primer sequences are:
(GAPDH-F: CTCTCTGCTCCTGTTCGACAG,
GAPDH-R: GTGTAATCATATTGGAACATGTAG,
iNOS-F: ACTCAGCCAAGCCCTCACCTAC.
iNOS-R: TCCAATCTCTGCCTATCCGTCTCG.
IL-1β-F: TCGCAGCAGCACATCAACAAGAG.
IL-1β-R: AGGTCCACGGGAAAGACACAGG).
(GAPDH-F: CTCTCTGCTCCTGTTCGACAG,
GAPDH-R: GTGTAATCATATTGGAACATGTAG,
iNOS-F: ACTCAGCCAAGCCCTCACCTAC.
iNOS-R: TCCAATCTCTGCCTATCCGTCTCG.
IL-1β-F: TCGCAGCAGCACATCAACAAGAG.
IL-1β-R: AGGTCCACGGGAAAGACACAGG).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!