Mouse monoclonal anti ago2

Magna Bind goat anti-mouse IgG magnetic bead slurry, 100 μL, (Thermo Scientific, Waltham, USA) was incubated with 10 μg of mouse monoclonal anti-Ago2 (Abcam, Cambridge, UK) or mouse normal IgG (Santa Cruz Biotechnology, Dallas, US) antibodies for 2 h at 4 °C. The antibody-coated beads were then added to plasma and incubated overnight at 4 °C with rotation. Beads were washed and each sample then eluted in RNAse free water before QIAzol was added for RNA isolation. Ago2 isolation was determined by western blot analysis.

The Flag-tagged L11 (Flag-L11) and pGL3-myc 3′UTR luciferase reporter plasmids were described previously [22 (link)], except that the mutant with the deletion of the BS-1 (pGL3-myc-3′UTRΔBS1) was constructed by PCR using pGL3-myc 3′UTR plasmid as a template. The primers used are: 5′- CGCTCTAGAGGAAAAGTAAGGAAAACGATAGCAA TCACCTATGAACTTG-3′ (forward) and 5′-CGCTCTAGA TTGGCTCAATGATATATTTGCCA G-3′ (reverse). The PCR product was then cloned into pGL3-promoter plasmid (Promega) at the Xba I site and sequenced. Anti-Flag (M2; Sigma), rabbit polyclonal anti-Ago2 (Millipore), mouse monoclonal anti-Ago2 (Abcam), and mouse polyclonal anti-Myc (Y69; Abcam) antibodies were purchased. Rabbit polyclonal anti-L11 antibodies were previously described [56 (link)].

An AGO2-specific antibody was used for AGO2 immunoprecipitation, and an IgG antibody was selected as the negative control. Mouse monoclonal anti-AGO2 (Abcam, Cambridge, England) or mouse normal IgG antibody (Abcam, Cambridge, England) were preincubated with Magna Bind goat anti-mouse IgG Magnetic Bead slurry (Thermo Fisher Scientific, Waltham, MA, United States) and used for immunoprecipitation. In brief, cells were lysed in 150 mM KCl, 25 mM Tris-HCl, pH 7.4, 5 mM EDTA, 0.5% Triton X-100, and 5 mM DTT supplemented with RNase inhibitor (Takara, Tokyo, Japan) and proteinase inhibitor cocktail (Roche Applied Science, Basel, Switzerland). The lysate was mixed with antibody-coupled Sepharose beads and left under rotation for 4 h at 4°C. Beads were subsequently washed six times in lysis buffer and the RNA was extracted using Trizol reagent(Takara, Tokyo, Japan).