Dna extraction kit

Based on the previous results from the adhesion/invasion assay, we selected 34 strains for sequence typing (Du et al., 2016 (link)). Based on the manufacturer’s instruction for the DNA Extraction Kit (Omega Bio-Tek, Norcross, GA, United States), genomic DNA from the 34 strains was obtained after overnight cultivation. Primers for seven housekeeping genes (atpD, fusA, glnS, gltB, gyrB, infB, and pps) were used for PCR (Baldwin et al., 2009 (link)), and the amplified products were sequenced with the Sanger chain termination method by Suzhou Jinweizhi Biotechnology Co., Ltd. (Suzhou, China). The sequencing results of the seven housekeeping genes were concatenated in a certain order to match with the PubMLST database and used to construct a phylogenetic tree by MEGA 6.0. The relationships among the 34 strains were analyzed via the neighbor-joining statistical method coupled with Tamura’s 3-parameter model (Joseph and Forsythe, 2012 (link)).

The total DNAs of the plants and associated microbes were extracted from 10 twigs (0.5–1 cm in length) per tree using a DNA extraction kit (Omega Bio-tek, Norcross, GA, USA), and the resultant DNA extracts were evaluated via 1% agarose gel electrophoresis. The DNA concentrations were quantified using a NanoDrop2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and normalized for use as the templates for generating PCR amplicons. Total DNA was extracted from fungal mycelia and cultured on PDA with cellophane using the phenol-based method as described previously [33 (link)].

According to the minor allele frequency (MAF), more than 5% in the Chinese population (http://browser.1000genomes.org/index.html), the heterozygosity and the location in the MC4R gene, six SNPs, including rs2331841 (A/G), rs656710 (C/T), rs17782313 (C/T), rs571312 (A/C), rs12970134 (A/G), and rs11872992 (A/G), were selected for further association study in our total of 1100 DNA samples.
Genomic DNA was extracted from peripheral white blood cells using a DNA extraction kit (Omega Biotek, GA, USA) according to the manufacturer's instructions. A Mass ARRAY MALDI-TOF system (Sequenom Inc., San Diego, CA, USA) was used for genotyping the candidate SNPs. Hardy–Weinberg equilibrium was assessed by the exact test using Plink software (version 1.06, http://pngu.mgh.harvard.edu/purcell/plink).

Power Pac 3000 electrophoresis apparatus (Bio-Rad, USA), IX71 inverted microscope (Olympus, Japan), Gradient A10 Mill-Q ultrapure water (Millipore, USA), Forma-86CULT Freezer ultra-low temperature refrigerator (Thermo electron), Extraction cleaner (KQ5200E), automatic biochemical analyzer (Mindray BS-300), microplate reader (Thermo Fisher Scientific), polymerase chain reaction (PCR) instrument (ABI GeneAmp^® 9700, ABI, USA), ultra-microspectrophotometer (Nano Drop 2000, Thermo Fisher Scientific), Sartorius BSA224S-CW microanalytical balance (d = 0.1 mg), and refrigerated centrifuge (Sigma, Germany) were used.
Triptolide (China Food and Drug Control Institute, 111567-201404) and DSS were purchased from MP Biomedicals (MW; 36,000–50,000; MP Biomedicals, Solon, OH, USA). Enzyme-linked immunosorbent assay (ELISA) kits for tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-17 were supplied by Thermo Fisher Scientific; aspartate aminotransferase assay kit, alanine aminotransaminase test kit, and mesalazine (enteric-coated) tablets were procured from Losan Pharma GmbH (Germany). In addition, TransStart FastPfu DNA Polymerase (AP221-02, Beijing Quanjin Biotechnology Co., Ltd.), DNA extraction kit (Omega Bio-Tek, US), and Illumina MiSeq platform (Illumina MiSeq PE300, Illumina, USA) were obtained.

BSP was performed to examine the methylation level of the BMPER promoter. The BSP primer sequences used were as follows: forward primer – GTGTGTCGCTCCTTCCCAAAGGTG and reverse primer - GCCCTGGGGCCCTGGCCTCC. Genomic DNA from Hep3B and PLC/PRF/5 cells was extracted using the DNA extraction kit (Omega Bio Tek). Ten randomly selected positive clones were sequenced, and the sequencing results were visualized using SeqMan software.