Pex 1 vector

Manufactured by GenePharma

Sourced in China

The PEX-1 vector is a plasmid-based expression system used for recombinant protein production in eukaryotic cells. Its core function is to facilitate the cloning and expression of target genes under the control of a strong promoter, enabling the production of desired proteins in a cellular environment.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 3000 reagent, by Thermo Fisher Scientific (4 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions) Scrambled control sirna, by GenePharma (1 mentions) Si nc, by RiboBio (1 mentions)

Spelling variants of this product

PEX vector (2 citations) PEX-1 (2 citations)

5 protocols using pex 1 vector

Silencing or Overexpressing Human FLIPS in L-02 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene silencing or overexpression of human FLIP_S (short form of FLIP) (NM_001127184.3), L-02 cells cultured in 24-well plates were transfected with scrambled control siRNA, FLIP_S siRNA, pEX-1 vector, or pEX-1 vector carrying FLIP_S sequence obtained from Genepharma (Shanghai, China). SiRNA or plasmid were transfected into the cells using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocols. The siRNA sequences are listed in Table 1. After 24 h transfection, fresh DMEM medium was added to the plates to replace the transfection medium for another 24 h before the treatment of TP (25 nmol/L) and TNF-α (50 ng/mL). Cell supernatant and lysate for LDH detection and Western Blot analysis were collected 24 h after TNF-α application.Table 1

Sequence of target gene siRNA.

Table 1

Gene	Gene sequence (5′–3′)
Negative control sense	UUCUCCGAACGUGUCACGUTT
Negative control antiense	ACGUGACACGUUCGGAGAATT
FLIP_S sense	GGAGAAACUAAAUCUGGUUTT
FLIP_S antisense	AACCAGAUUUAGUUUCUCCTT

Yuan Z., Yuan Z., Hasnat M., Zhang H., Liang P., Sun L., Jiang Z, & Zhang L. (2020). A new perspective of triptolide-associated hepatotoxicity: the relevance of NF-κB and NF-κB-mediated cellular FLICE-inhibitory protein. Acta Pharmaceutica Sinica. B, 10(5), 861-877.

+ Open protocol

+ Expand

Overexpression of PFKFB3, TLR4, and NF-κB1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pEX-1 vector (GenePharma, Shanghai, China) was used for PFKFB3 overexpression. The pEX-1 vector (Genechem, Shanghai, China) was used for TLR4 and NF-κB1 overexpression. The empty plasmid vector was used as the control. These plasmids were transfected into cells using Lipofectamine 3000 Reagent (Thermo Fisher Scientific) as required. The cells were transfected for 48 h and then collected for subsequent analyses. The transfection efficiency was evaluated using western blotting.

Zhang Y., Liu W., Zhong Y., Li Q., Wu M., Yang L., Liu X, & Zou L. (2021). Metformin Corrects Glucose Metabolism Reprogramming and NLRP3 Inflammasome-Induced Pyroptosis via Inhibiting the TLR4/NF-κB/PFKFB3 Signaling in Trophoblasts: Implication for a Potential Therapy of Preeclampsia. Oxidative Medicine and Cellular Longevity, 2021, 1806344.

+ Open protocol

+ Expand

Cloning and Expression of FTO

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length Fto mRNA (1 506 bp) and a fragment without the NLS (1 458 bp) were cloned and inserted into the pEX-1 vector (C05001, GenePharma, China) using XhoI/EcoRI restriction enzyme sites to construct FTO-green fluorescent protein (GFP)/ΔFTO-GFP fusion expression vectors, respectively. The constructed vectors were confirmed by sequencing and designated as pEX-1-Fto and pEX-1-ΔFto, respectively. Detailed sequence information is shown in Supplementary Figure S1.

Zhang J.N., Wang R.T., Klinger F.G., Cheng S.F., Shen W, & Sun X.F. (2024). RNA m6A dynamic modification mediated by nucleus-localized FTO is involved in follicular reserve. Zoological Research, 45(2), 415-428.

+ Open protocol

+ Expand

Modulating CXCR7 Expression in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knockdown CXCR7 expression, specific siRNAs against human CXCR7, alone with the negative control, were transfected into HUVECs using Lipofectamine 3000 (Thermo Fisher, Waltham, MA). We selected 3 target sequences for CXCR7 and the negative control as follows: CXCR7-siRNA 1, forward (GCUAUGACACGCACUGCUATT), and reverse (UAGCAGUGCGUGUCAUAGCTT); CXCR7-siRNA 2, forward (GCAGCCGGAAGAUCAUCUUTT), and reverse (AAGAUGAUCUUCCGGCUGCTT); CXCR7-siRNA 3, forward (GCUUCAUCAAUCGCAACUATT), and reverse (UAGUUGCGAUUGAUGAAGCTT); negative control, forward (UUCUCCGAACGUGUCACGUTT), and reverse (ACGUGACACGUUCGGAGAATT). After transfection for 48 h, the expression of CXCR7 was determined by quantitative real-time PCR and western blot.
To upregulate the CXCR7 expression in HUVECs, the plasmid encoding overexpressed CXCR7 was constructed by cloning the CXCR7 gene into XhoI and EcoRI sites on pEX-1 vector (Shanghai GenePharma, Shanghai, China). The CXCR7 cDNA was amplified using the following primers: forward (CGCAAATGGGCGGTAGGCGTG) and reverse (TAGAAGGCACAGTCGAGG). HUVECs were transfected with recombinant CXCR7 or control vector using Lipofectamine 3000 overnight. After transfection for 48 h, the efficiency was determined by quantitative real-time PCR and western blot.

Shen M., Feng Y., Wang J., Yuan Y, & Yuan F. (2020). CXCR7 Inhibits Fibrosis via Wnt/β-Catenin Pathways during the Process of Angiogenesis in Human Umbilical Vein Endothelial Cells. BioMed Research International, 2020, 1216926.

+ Open protocol

+ Expand

PFKFB3 and MALAT1 Modulation in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pEX-1 vector (GenePharma, Shanghai, China) was used for PFKFB3 overexpression, and an empty plasmid vector was used as a control. PFKFB3 was silenced by siRNAs, and si-NC, serving as a NC, was purchased from RiboBio (Guangzhou, China). Three siRNAs targeting the PFKFB3 gene were designed and synthesized, and the most effective siRNA (si-3) identified by quantitative real-time PCR was utilized for further experiments. Four shRNAs targeting the MALAT1 gene were designed and synthesized by GenePharma, and the most effective shRNA (sh-5277) identified by quantitative real-time PCR was used for further experiments. The overexpression and inhibition of miR-26a/26b were achieved using miR-26a/26b mimics and miR-26a/26b inhibitors, respectively, with NC mimics and NC inhibitors serving as controls (GenePharma). These plasmids were transfected into cells using Lipofectamine 3000 Reagent (Thermo Fisher Scientific, Waltham, MA, USA) as required. The cells were transfected for 48 h and then collected for subsequent analyses.

Li Q., Liu X., Liu W., Zhang Y., Wu M., Chen Z., Zhao Y, & Zou L. (2021). MALAT1 sponges miR-26a and miR-26b to regulate endothelial cell angiogenesis via PFKFB3-driven glycolysis in early-onset preeclampsia. Molecular Therapy. Nucleic Acids, 23, 897-907.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!