Turbo dnase kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Singapore, Japan, United Kingdom, Denmark

The Turbo DNase kit is a lab equipment product designed for the rapid and efficient removal of DNA from RNA samples. It utilizes a thermostable DNase enzyme to effectively degrade DNA, ensuring the purity of the remaining RNA for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

163 protocols using turbo dnase kit

RNA-sequencing of ESC and NPC Knockdowns

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from WT26 ESCs and NPCs as biological triplicates using TRIzol Reagent and treated with the TURBO Dnase kit (Ambion).
For RNA-seq of knockdowns, feeder-free WT26 ESCs were transduced with shRNAs specific for Msl1, Msl2, Mof, Kansl3 and control shRNA as biological triplicates as described above. Briefly, following transduction for 24 hr, cells were washed with PBS thrice to remove the viral supernatant and subjected to puromycin selection (1.5 µg/ml) for 24 hr. In the case of Msl1/2, Mof, control shRNA the cells were maintained in puromycin selection for 4 days and in case of Kansl3, the cells were maintained in puromycin-selection for 84 hr. An additional set of control shRNA was performed alongside with Kansl3 for 84 hr. Total RNA from all the shRNA-treated cells was extracted using TRIzol Reagent and the samples were treated with DNase using the TURBO Dnase kit (Ambion). The quality of the RNA was analyzed using the Bioanalyzer and samples with RIN values between 9 and 10 were used for RNA-seq. For RNA-seq analysis, cDNA libraries were prepared using the Illumina TruSeq Stranded mRNA kit with 3 μg DNase-treated samples.

Chelmicki T., Dündar F., Turley M.J., Khanam T., Aktas T., Ramírez F., Gendrel A.V., Wright P.R., Videm P., Backofen R., Heard E., Manke T, & Akhtar A. (2014). MOF-associated complexes ensure stem cell identity and Xist repression. eLife, 3, e02024.

+ Open protocol

+ Expand

Whole-body RNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individuals (whole-bodies) from all developmental stages were mechanically homogenized with beads (Sigmund Linder) in liquid nitrogen. We then added 900 ul Trizol (Life Technologies), followed by 180 ul chloroform and 350 ul ethanol. The aqueous layer was then transferred to RNeasy MinElute Columns (Qiagen). Upon RNA extraction, samples were treated with DNase Turbo Kit (Life Tech) following the manufacturer’s protocol. Total RNA from the hatchlings was extracted with MagMaxTM Express Robot (AB Applied Biosystems) using a MagMAXTM-96 Total RNA Isolation Kit from Ambion (Life Technologies) following the manufacturer’s protocol, but without DNAse at this step to preserve DNA for the sex determination of hatchlings via genotyping (see below). Following RNA extraction, hatchling samples were treated with DNase Turbo Kit (Life Tech) following the manufacturer’s protocol. The quality and quantity of the extracted RNA was then measured using a NanoDrop and Bioanalyzer. Library preparations (one for each individual) were done using the Illumina TruSeq Stranded Total RNA kit, upon which samples were sequenced together in six lanes. Paired-end sequencing with a read length of 100 bp was done on a HiSeq2000 platform at the GTF (Genomic Technologies Facility, Centre of Integrative Genomics, Lausanne, Switzerland).

Djordjevic J., Dumas Z., Robinson-Rechavi M., Schwander T, & Parker D.J. (2022). Dynamics of sex-biased gene expression during development in the stick insect Timema californicum. Heredity, 129(2), 113-122.

+ Open protocol

+ Expand

Whole-body RNA Extraction and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Individuals (whole-bodies) from all developmental stages were mechanically homogenized with beads (Sigmund Linder) in liquid nitrogen. We then added 900 ul Trizol (Life Technologies), followed by 180 ul * chloroform and 350 ul ethanol. The aqueous layer was then transferred to RNeasy MinElute Columns (Qiagen). Upon RNA extraction, samples were treated with DNase Turbo Kit (Life Tech) following the manufacturer's protocol. Total RNA from the hatchlings was extracted with MagMaxTM Express Robot (AB Applied Biosystems) using a MagMAXTM-96 Total RNA Isolation Kit from Ambion (Life Technologies) following the manufacturer's protocol, but without DNAse at this step to preserve DNA for the sex determination of hatchlings via genotyping (see below). Following RNA extraction, hatchling samples were treated with DNase Turbo Kit (Life Tech) following the manufacturer's protocol. The quality and quantity of the extracted RNA was then measured using a NanoDrop and Bioanalyzer. Library preparations (one for each individual) were done using the Illumina TruSeq Stranded Total RNA kit, upon which samples were sequenced together in six lanes. Paired-end sequencing with a read length of 100 bp was done on a HiSeq2000 platform at the GTF (Genomic Technologies Facility, Centre of Integrative Genomics, Lausanne, Switzerland).

Djordjevic J., Zoé D., Robinson‐Rechavi M., Schwander T., & Parker D.J. (2021). Dynamics of sex-biased gene expression during development in the stick insectTimema californicum.

+ Open protocol

+ Expand

Validating Intergenic Variation in Mycobacterium Tuberculosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The intergenic variation mapping between embC and embAB genes inVPCI591 was validated by Sanger sequencing using the primers, forward (CCTAGGAACGGTGACTCG) and reverse (AGACGACGGCTGCTAGGC). For expression analysis total RNA was extracted from the clinical isolate VPCI591 and H37Rv using the RNeasy mini kit (Qiagen) and was treated with DNase using TURBO™ DNase kit (Invitrogen) and cDNA was prepared using First strand cDNA synthesis kit (Fermentas K1612). Quantitative PCR was performed with sigA/Rv2703 gene as control and fold change was measured by ΔΔCt method using FastStart universal master mix (Roche). The following primers were used: embA (F- GTAATGAGCGATCTCACCGG/ R- CGGTGATCTGGGTGATGTTG); sigA (F- AACGCACCGCCACCAAGTC/ R- TGGTGCTGGTCGTAGTGTCCTG).

Bhattacharyya K., Nemaysh V., Joon M., Pratap R., Varma-Basil M., Bose M, & Brahmachari V. (2020). Correlation of drug resistance with single nucleotide variations through genome analysis and experimental validation in a multi-drug resistant clinical isolate of M. tuberculosis. BMC Microbiology, 20, 223.

+ Open protocol

+ Expand

Bulk nuclear RNA-seq protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For bulk nuclear RNA-seq, nuclei were sorted based on the aforementioned gating criteria following isolation. Sorted nuclei were washed in PBS-N as for snRNA-seq but skipping additional filtration. Nuclear RNA was extraction using TRIzol as stated above. Additionally, the extracted RNA was purified by on-column DNA digestion using TURBO DNase kit (Invitrogen). For library construction, 20–50 ng of purified RNA was processed by NEBNext rRNA Depletion Kit (New England BioLabs, Inc.) for removing ribosomal RNA, Next the RNA was converted to cDNA using Maxima Reverse Transcriptase (Thermo Fisher Scientific) and NEBNext mRNA Second Strand Synthesis kit. Following purification based on size selection using AMPure XP beads (Beckman Coulter), sequencing libraries were generated through tagmentation using Nextera XT DNA Library Preparation kit and subsequent PCR amplification. The quantity and quality of the resulting libraries were assessed using Qubit and Agilent Bioanalyzer, respectively. Finally, the libraries were sequenced on an Illumina NextSeq500.

So J., Strobel O., Wann J., Kim K., Paul A., Acri D.J., Dabin L.C., Kim J, & Roh H.C. (2024). Robust single nucleus RNA sequencing reveals depot-specific cell population dynamics in adipose tissue remodeling during obesity. bioRxiv.

+ Open protocol

+ Expand

Transcriptome Analysis of Bacterial RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

At optical densities of 0.1, 0.4, 1, and 3, further growth was halted and intracellular RNA was stabilized by the addition of a 0.4 volume of stop solution (5% [vol/vol] phenol [pH 4.3]–ethanol) and incubation on ice for 30 min. A volume of cells equivalent to a cell density of 1 ml of culture at an A₆₀₀ of 1 was harvested. Cells were pelleted by centrifugation at 3,220 × g for 10 min at 4°C. Cells were resuspended in Tris-EDTA buffer (TE; pH 8.0) containing 50 mg/ml lysozyme. RNA was extracted using an SV total RNA isolation kit (Promega, WI, USA). RNA was DNase treated using a Turbo DNase kit (Invitrogen). RNA integrity was assessed on a HT gel (77 (link)) and quantified using a DeNovix DS-11 spectrophotometer and A₂₆₀.
RNA (400 ng) was reverse transcribed into cDNA using random oligonucleotides and a GoScript reverse transcriptase kit (Promega). The cDNA was probed using primers specific to target genes in the StepOnePlus real-time PCR system as described above. The hemX gene was used as a control gene (with unchanged expression assumed), and the changes in expression of the other genes were calculated against hemX expression.
The oligonucleotide primer pairs used in qPCR are listed in Table S1.

Bogue M.M., Mogre A., Beckett M.C., Thomson N.R, & Dorman C.J. (2020). Network Rewiring: Physiological Consequences of Reciprocally Exchanging the Physical Locations and Growth-Phase-Dependent Expression Patterns of the Salmonella fis and dps Genes. mBio, 11(5), e02128-20.

+ Open protocol

+ Expand

RNA Editing Analysis in HEK293T and HeLa Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HEK293T and HeLa cells using 1 mL Trizol Reagent (Invitrogen) according to manufacturer's instructions. DNA was removed from RNA samples using the Turbo™ DNase kit (Invitrogen), and following the rigorous DNase treatment procedure, cDNA was prepared from 1 μg of DNase-treated RNA sample using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). When preparing cDNA, a control reaction lacking reverse transcriptase (–RT) was prepared in parallel for each RNA sample to ensure the absence of genomic DNA contamination. PCR amplicons were generated using the target-specific primers listed in Table 1 and then sequenced. RNA editing in HEK293T cells was quantified using a high-throughput sequencing-based strategy, as described previously (32 (link)). RNA editing levels in HeLa cells were determined by quantifying the relative peak heights at edited positions in Sanger sequencing-derived electropherograms (44 (link)).

Malik T.N., Doherty E.E., Gaded V.M., Hill T.M., Beal P.A, & Emeson R.B. (2021). Regulation of RNA editing by intracellular acidification. Nucleic Acids Research, 49(7), 4020-4036.

+ Open protocol

+ Expand

Total RNA Extraction from Sludge Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from sludge samples using the Soil, Fecal and Plant RNA kit (Zymo Research, USA) as described [68 (link), 69 ], according to the manufacturer’s guidelines. Extracted RNA underwent a single round of DNase treatment to remove residual DNA (TURBO™ DNase kit; Invitrogen, Singapore). The quality of the extracted RNA was measured by spectrophotometry (Nanodrop; Thermo Scientific, USA). The concentration of RNA and residual DNA was determined by fluorometry (Qubit® 2.0 Fluorometer; Invitrogen, USA), using the Qubit® RNA broad range assay kit (Invitrogen, USA) and Qubit® DNA high sensitivity range assay kit respectively, following the manufacturer’s guidelines. In addition, the integrity of the RNA was determined using the RNA Analysis ScreenTape and 2200 Tapestation instrument (Agilent Technologies, Singapore) and reported as the RNA Integrity Number (RIN). These RNA samples were subsequently sent for RNA library preparation prior to pooling and sequencing on an Illumina HiSeq 2500 System (Illumina Inc.) using 100 bp paired-end (PE) sequencing as per the manufacturer’s guidelines.

Chan S.H., Ismail M.H., Tan C.H., Rice S.A, & McDougald D. (2021). Microbial predation accelerates granulation and modulates microbial community composition. BMC Microbiology, 21, 91.

+ Open protocol

+ Expand

Hormone-Dependent Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

T-47D and MDA-MB-453 cells were seeded at 0.5 × 10⁶ cells/well in a 6-well dish and hormone starved for 48 h followed by hormone treatment as described above. For siRNA experiments, cells were simultaneously transfected with siRNAs against GATA3 or AR. After treatment with vehicle (0.001% EtOH) or DHT (10 nM) for 6 h, total RNA was extracted with TriReagent (Sigma) followed by DNase treatment using the TURBO DNase Kit (Invitrogen) according to manufacturer’s protocol. Reverse transcription was performed with 500 ng of total RNA using the iScript cDNA Synthesis Kit (BIO-RAD). The resulting cDNA was diluted 1:10 and used for qRT-PCR and mRNA levels were normalized to GAPDH using the ΔΔCt method in BIO-RAD CFX-manager software. Additional file 9 outlines RT-PCR primers used herein.

Hosseinzadeh L., Kikhtyak Z., Laven-Law G., Pederson S.M., Puiu C.G., D’Santos C.S., Lim E., Carroll J.S., Tilley W.D., Dwyer A.R, & Hickey T.E. (2024). The androgen receptor interacts with GATA3 to transcriptionally regulate a luminal epithelial cell phenotype in breast cancer. Genome Biology, 25, 44.

+ Open protocol

+ Expand

Quantification of Targeted Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For all expression analysis in this work, tissue was collected from systemic tissues on plants treated with ViN vectors and RNA was extracted using the TRIZOL reagent (Invitrogen). After a DNAse treatment with the TURBO-DNAse kit (Invitrogen), the concentration of RNA of the targeted genes, the ViN vectors and housekeeping genes was quantified using RT-qPCR performed with the one-step SuperScript RT-PCR kit (Invitrogen) on a BioRAD thermocycler. Reactions were scaled down to 12.5 μL with 50 ng of RNA per reaction to conserve reagents. Between one and two technical replicates were performed on all samples. The RT-qPCR primers used are listed in Supplemental Table S3.

Khakhar A., Wang C., Swanson R., Stokke S., Rizvi F., Sarup S., Hobbs J, & Voytas D.F. (2021). VipariNama: RNA viral vectors to rapidly elucidate the relationship between gene expression and phenotype. Plant Physiology, 186(4), 2222-2238.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!