In fusion hd ecodry cloning kit

Manufactured by Takara Bio

Sourced in Japan, United States

The In-Fusion HD EcoDry Cloning Kit is a molecular biology tool that enables fast and efficient cloning of DNA fragments. The kit contains pre-formulated, freeze-dried reagents that facilitate the seamless insertion of DNA sequences into vectors.

Automatically generated - may contain errors

Lab products found in correlation

Glutamax, by Thermo Fisher Scientific (2 mentions) Pmcherry c1, by Takara Bio (2 mentions) Pmetluc2 control, by Takara Bio (2 mentions) Neb hifi assembly, by New England Biolabs (2 mentions) On targetplus non targeting control pool, by Horizon Discovery (2 mentions) Flag rap1b v12, by Addgene (1 mentions) Flag rap1b n17, by Addgene (1 mentions) Ptre tight vector, by Takara Bio (1 mentions) Effectene, by Qiagen (1 mentions) Tet on advanced gene expression system, by Takara Bio (1 mentions) Pegfp c1 mammalian expression vector, by BD (1 mentions) Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (1 mentions) Rneasy kit, by Qiagen (1 mentions) Pbelobac11, by New England Biolabs (1 mentions) Gblock gene fragment, by Integrated DNA Technologies (1 mentions) Cloneamp hifi pcr premix, by Takara Bio (1 mentions) Ndei and hindiii, by New England Biolabs (1 mentions) Amplitaq gold master mix, by Thermo Fisher Scientific (1 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

In-Fusion HD EcoDry Cloning Plus kit In-Fusion HD Cloning Kit In-Fusion HD Cloning In-Fusion HD kit In-Fusion cloning In-Fusion HD In-Fusion kit In-Fusion EcoDry kit

24 protocols using in fusion hd ecodry cloning kit

Cloning and Purification of TAT-Myc-RhoA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pin1 inhibitory peptides (TAT-WW and its mutant TAT-W34A) were synthesized and purified at Genemed Synthesis Inc. (San Antonio, TX, USA). The full-length Pin1 and GFP cDNAs were cloned in frame into a pHis-TAT vector for His6-TAT-HA-proteins. The pHis-TAT vector BamHI site between the His tag and the TAT tag was mutated to GGTTCC using PCR mutagenesis. The vector was digested with BamHI and EcoRI to remove the HA tag. A PCR reaction generated BamHI-Myc-RhoA-EcoRI from pRK5-Myc-RhoA (Addgene) (Watertown, NY, USA) and the product was cloned into the modified backbone using the In-Fusion™ HD EcoDry Cloning kit (Takara Bio Inc.) (Kusatsu, Japan) to yield His6-TAT-Myc-RhoA. Proteins were expressed in Escherichia coli and purified on a Ni2⁺ chelate column. The TAT-peptides were more than 90% pure on Coomassie blue staining of SDS-PAGE.

Shen Z.J., Hu J., O’Neal M.A, & Malter J.S. (2021). Pin1 Regulates IL-5 Induced Eosinophil Polarization and Migration. Cells, 10(2), 211.

+ Open protocol

+ Expand

Construction of Multimeric Affibody Fusion Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Like other β-wrapins derived from the affibody ZAβ3, AS10 is a dimer of two identical subunits [43] (link). In the fusion constructs the two AS10 subunits and the β-hairpin-forming peptides were linked via flexible glycine-serine linkers in the following format: N-His₆-AS10(subunit1)-(G₄S)₃-AS10(subunit2)-(G₄S)₃-HairpinPeptide-C. DNA fragments containing the sequence of the fusion constructs were obtained from Thermo Fisher Scientific and cloned into vector pET302/NT-His using In-Fusion HD EcoDry Cloning Kit (Takara Bio). The success of the cloning was verified by sequencing.

Heid L.F., Agerschou E.D., Orr A.A., Kupreichyk T., Schneider W., Wördehoff M.M., Schwarten M., Willbold D., Tamamis P., Stoldt M, & Hoyer W. (2023). Sequence-based identification of amyloidogenic β-hairpins reveals a prostatic acid phosphatase fragment promoting semen amyloid formation. Computational and Structural Biotechnology Journal, 23, 417-430.

+ Open protocol

+ Expand

CRISPR-Cas9 Editing of Integrin β2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNAs encoding the full-length human αL and β2 proteins were amplified by RT-PCR and cloned into a pLVX lentiviral expression vector. Cloning of β2 point mutants L697P was done by oligonucleotide-directed mutagenesis using Infusion-HD Eco Dry Cloning Kit (Takara Bio USA, Inc. Clontech, Mountain View, CA, USA). The pCas9-enhanced GFP (EGFP) plasmid was purchased from Addgene, Watertown, MA, USA (plasmid #48138). The pTLN1gRNA-Cas9-DasherGFP plasmid was provided by Horizon Discovery (Cambridge, United Kingdom). The sgRNA sequences were as followed: β2-sgRNA1: gccgggaatgcatcgagtcg ggg; β2-sgRNA2: gtgacgctttacctgcgacc agg (PAM sequences are highlighted by italic and underline). TLN1-gRNA: GGATCCGCTCACGAATGATG. All constructs were confirmed by DNA sequencing.

Sun H., Fan Z., Gingras A.R., Lopez-Ramirez M.A., Ginsberg M.H, & Ley K. (2019). Frontline Science: A flexible kink in the transmembrane domain impairs β2 integrin extension and cell arrest from rolling. Journal of leukocyte biology, 107(2), 175-183.

+ Open protocol

+ Expand

Construction of Chlamydia Fluorescent Reporters

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All constructs were created in the p2TK2SW2 plasmid background (38 (link)). Promoters and the ftsI ORF were amplified from C. trachomatis L2 (LGV Bu434) genomic DNA using the indicated primers (see Table S1 in the supplemental material). Fluorescent reporters were ordered as gBlocks and cloned using the In-Fusion HD EcoDry Cloning kit (TaKaRa). Promoter reporter constructs were created as previously described (10 (link), 39 (link)). The p2TK2SW2-E-ftsI3XFLAG was generated by replacing the Clover gene with the ftsI ORF in the previously created p2TK2SW2-E-Clover-3XFLAG plasmid (12 (link)). Dual promoter reporter cassettes [euoprom-mNG(LVA)_hctBprom-mKate2 and hctAprom-mEos3.2_hctBprom-mKate2] were then inserted upstream of E-ftsI-3XFLAG to produce the p2TK2SW2-E-ftsI-3XFLAG_euoprom-mNG(LVA)_hctBprom-mKate2, and p2TK2SW2-E-ftsI-3XFLAG_hctAprom-mEos3.2_hctBprom-mKate2 constructs.

Chiarelli T.J., Grieshaber N.A., Appa C, & Grieshaber S.S. (2023). Computational Modeling of the Chlamydial Developmental Cycle Reveals a Potential Role for Asymmetric Division. mSystems, 8(2), e00053-23.

+ Open protocol

+ Expand

Cloning Hef3-FLAG Fusion Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HEF3 gene was amplified from genomic DNA from the BY4741 wild-type yeast strain using the following primers: 5′-CAAAAAAAAAGTAAGAATTTTTGAAAATTCCAATCTAATAGAGAAGGG-3′ and 5′-CGTCATCCTTGTAATCCATCGATACTAGTGCAAAATCTTCATCAGAAGAAACG-3′. The polymerase chain reaction (PCR) product was cloned into the pESC-URA vector in frame to the FLAG-tag at the C-terminus of Hef3p using the recombination technique with the In-Fusion HD EcoDry Cloning Kit (TaKaRa, Kyoto, Japan) according to the manufacturer’s instructions. The resulting construct expresses Hef3-FLAG under the Gal1-Gal10 inducible promoter (pUT01).

Gościńska K., Shahmoradi Ghahe S., Domogała S, & Topf U. (2020). Eukaryotic Elongation Factor 3 Protects Saccharomyces cerevisiae Yeast from Oxidative Stress. Genes, 11(12), 1432.

+ Open protocol

+ Expand

Production and Validation of Rap-related Lentiviruses

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

pcDNA3 plasmids containing Flag-Cebpa (66978), Flag-Trib1 (131156), Flag-Rap1b N17 (118322), and Flag-Rap1b V12 (118323) were purchased from Addgene. Plasmids containing Rap2a (55666) and Rap2b (55667) were also purchased from Addgene. Plasmids containing Rap2a and Rap2b genes were transferred to the pcDNA3 vector and mutated to dominant=negative N17 and constitutively active V12 using the In-fusion HD EcoDRy Cloning Kit from Takara (639690) according to the manufacturer’s protocol. Furthermore, Rap2a mutants, Cebpa, and Trib1 were cloned into pLVX for lentiviral production. Lentivirus particles were produced in HEK293T LentiX cells (ATCC) as previously described (81 (link)) and used to treat 3T3L1 and PPDIVs.

Valentine J.M., Ahmadian M., Keinan O., Abu-Odeh M., Zhao P., Zhou X., Keller M.P., Gao H., Yu R.T., Liddle C., Downes M., Zhang J., Lusis A.J., Attie A.D., Evans R.M., Rydén M, & Saltiel A.R. (2022). β3-Adrenergic receptor downregulation leads to adipocyte catecholamine resistance in obesity. The Journal of Clinical Investigation, 132(2), e153357.

+ Open protocol

+ Expand

Generating Doxycycline-Inducible TopBP1 Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Previously cloned (14 (link)) human full-length TopBP1 coding sequence (CDS, Uniprot Q92547) was ligated into pEGFP-C1 mammalian expression vector (BD Biosciences, Genbank #U55763). Mutated TopBP1 in pEGFP-C1 was generated by introducing a tryptophan (W) to arginine (R) mutation at amino acid 1145 of TopBP1 using overlap extension polymerase chain reaction (PCR). For the preparation of stable Tet-On Advanced cell lines, the whole CDS of eGFP-TopBP1 WT or eGFP-TopBP1 W1145R was ligated to the pTRE-Tight vector (Clontech). TopBP1 deletion mutants were prepared and ligated into pEGFP-C1 vector using In-Fusion HD EcoDry Cloning Kit (Clontech). The correct sequences of all constructs were verified by sequencing (ABI Prism 310 Genetic Analyzer). DNA transfections were done with Effectene (Qiagen) transfection reagent.
Stable doxycycline-inducible U2OS cell lines were generated using Tet-On Advanced gene expression system (Clontech). Cells were designed to express either wild-type (WT) or W1145R mutant of human TopBP1 N-terminally fused to Enhanced Green Fluorescent Protein (eGFP).

Sokka M., Rilla K., Miinalainen I., Pospiech H, & Syväoja J.E. (2015). High levels of TopBP1 induce ATR-dependent shut-down of rRNA transcription and nucleolar segregation. Nucleic Acids Research, 43(10), 4975-4989.

+ Open protocol

+ Expand

Tandem Minigene Generation and Peptide Synthesis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

TMGs were constructed as described previously (40 (link)). For non-synonymous point mutations, each mutated amino acid was flanked bilaterally by a sequence encoding 12 wild type (WT) amino acids to generate an individual minigene. For each frameshift mutation, a minigene was designed to contain preceding 12 WT amino acids followed by mutated amino acids in the new reading frame, which terminated at the new stop codon. Next, up to twelve minigenes were linked together to generate tandem minigenes, which were codon-optimized, synthesized and ligated into a pcDNA3.1 vector using an In-Fusion HD EcoDry Cloning Kit (Clontech/Takara, Mountain View, CA). TMG RNA was made by in vitro transcription using a HiScribe T7 Quick High Yield RNA Synthesis Kit (New England BioLabs, Ipswich, MA). RNA samples were purified using RNeasy Kit (Qiagen, Germantown, MD), quantified by spectrophotometry, and stored at −80°C until further use. The amino acid sequences of each TMG used in this study are shown in Supplementary Table 1.
Crude or HPLC-purified (>90% purity) 25-mer peptides, each encoding a point mutation flanked on both sides with 12 WT amino acids, were synthesized by GenScript (Piscataway, NJ) as lyophilized power, resuspended in DMSO and stored at −20°C until use.

Leko V., McDuffie L.A., Zheng Z., Gartner J.J., Prickett T.D., Apolo A.B., Agarwal P.K., Rosenberg S.A, & Lu Y.C. (2019). Identification of neoantigen-reactive tumor-infiltrating lymphocytes in primary bladder cancer. Journal of immunology (Baltimore, Md. : 1950), 202(12), 3458-3467.

+ Open protocol

+ Expand

Cloning cDNA Amplicons into BAC Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA amplicons were inserted into the BAC vector pBeloBAC11 (New England BioLabs) using the In-Fusion HD Eco-Dry Cloning Kit (Clontech). Briefly, pBeloBAC11 was converted to a linearized form using the long PCR as above, with primers Kos15_NotI_pBelF and Kos15_NotI_pBelR (Additional file 1), which contain 15-nt overhangs identical to regions of the primers used for the preparation of the cDNA amplicons. The linear product was gel purified and quantified as described above. The linearized pBeloBAC11 vector was mixed with amplicons (ca. 1:2 molar ratio) in a volume of 10 μl, which was transferred to the In-Fusion HD EcoDry tube. The mixture was incubated at 37 °C for 15 min and then at 50 °C for 15 min. A 2.5 μl aliquot was used to transform E. coli Stellar competent cells according to the manufacturer’s protocol, and colonies grown on LB plates containing chloramphenicol (CAM) (15 μg/ml).

Johnston C.M., Fahnøe U., Belsham G.J, & Rasmussen T.B. (2018). Strategy for efficient generation of numerous full-length cDNA clones of classical swine fever virus for haplotyping. BMC Genomics, 19, 600.

+ Open protocol

+ Expand

Cloning and Mutagenesis of PfGSK3 Protein

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The vector with N-terminally His-tagged PfGSK3 was generated by PCR amplification of the GSK3 coding sequence from P. falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F [48 (link)] using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer's instructions. The mutants S226A, Y229A and S226A/Y229A were generated by overlap extension PCR amplification from the original vector and Ligation Independent Cloning as described above. The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning [49 (link)].

Pazicky S., Alder A., Mertens H., Svergun D., Gilberger T, & Löw C. (2022). N-terminal phosphorylation regulates the activity of glycogen synthase kinase 3 from Plasmodium falciparum. Biochemical Journal, 479(3), 337-356.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!