Total RNA was extracted from PASMC/HUVEC or PAH rat pulmonary artery tissue using TRIzol (Invitrogen) according to the manufacturer's instruction. For the mRNA expression test, 1 μg of total RNA was used to synthesize cDNA using a PrimeScript™ RT reagent kit (No. RR037A, TaKaRa) and the cDNA was used for quantitative PCR with the TB Green Premix Ex Taq™ kit (No. RR420, TaKaRa). For miRNA expression test, 1μg of total RNA extracted from HPASMC/HUVEC and miR‐508‐3p primer or U6 primer was employed to reverse transcribe with PrimeScript™ RT reagent. Then, the RT products were applied to quantitative PCR with TB Green Premix Ex Taq™ kit (No. RR420, TaKaRa). We set the thermal cycler conditions as follows: 30 seconds at 95.0℃ for cDNA denatured, 40 cycles of 95.0℃ for 5 seconds, 60℃ for 30 seconds and 1 minutes at 60.0℃. Each sample was performed in triplicate. GAPDH and U6 were referred to as internal control to calculate the relative gene expression and to calculate the relative miR‐508‐3p term, respectively. Both miRNA and gene expression level measured by qRT‐PCR were presented as 2−ΔΔCT. The primers for miR‐508‐3p, U6 and other detective genes are listed in Table 2 .
Tb green premix ex taq kit
Manufactured by Takara Bio
Sourced in Japan, China, United States, Switzerland
The TB Green Premix Ex Taq kit is a real-time PCR reagent designed for high-performance DNA amplification and quantification. It contains a proprietary DNA polymerase, buffer, and TB Green dye for efficient and sensitive detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (71 mentions)
Primescript rt reagent kit, by Takara Bio (43 mentions)
Primescript rt master mix kit, by Takara Bio (23 mentions)
Trizol, by Thermo Fisher Scientific (16 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (12 mentions)
Rnaiso plus, by Takara Bio (11 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (10 mentions)
Primescript rt master mix, by Takara Bio (9 mentions)
Trizol reagent, by Takara Bio (8 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Reverse transcription kit, by Takara Bio (7 mentions)
Cdna synthesis kit, by Takara Bio (6 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (6 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (6 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
All in one rt mastermix kit, by Applied Biological Materials (5 mentions)
Abi 7500 system, by Thermo Fisher Scientific (4 mentions)
Ficoll solution, by Solarbio (4 mentions)
Gdna eraser, by Takara Bio (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
188 protocols using tb green premix ex taq kit
1
Quantitative Analysis of RNA Expression
2
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of cells was isolated with RNAiso plus (Cat# 9108, Takara). The concentration and purity of RNA samples were measured using a Nanodrop ND-2000 (Thermo Science, MA, USA) for further experiments. Five hundred nanograms of RNA was converted to complementary DNA (cDNA), which was synthesized with a PrimeScript reverse transcriptase kit (Cat# RR037A, Takara). RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II, Roche). The primer sequences (Shanghai Generay Biotech Co., Ltd., Shanghai, China) were designed through Primer-BLAST2 and are listed in Supplementary Table 1 . The relative amounts of mRNA were calculated using the ΔΔCt relative quantification method. GAPDH served as the control gene, and the mRNA levels of specific genes were normalized to GAPDH. Calculations and statistics were performed in Microsoft Excel version 16.36. Graphs were plotted in GraphPad Prism 8 version 8.4.3. Three biological repeats were performed.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the cultured cells and retinas was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). The quality and concentration of RNA were measured using spectrophotometry at wavelengths of 260 nm and 280 nm. cDNA was synthesized using a PrimescriptTM RT Master Mix (Takara, Dalian, China) according to the manufacturer’s instruction. Quantitative real-time PCR was performed using the TB GreenTM Premix Ex Taq™ kit (Takara, Dalian, China). The PCR conditions were set as 30 s at 95 °C, followed by 5 s at 95 °C, 34 s at 60 °C. All PCR reactions were run on an ABI Prism 7000 sequence detection system (Applied Biosystems, Foster City, CA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control, and the 2-ΔΔCt algorithm was introduced to compare the expression of each gene across groups.
4
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of cells was isolated with RNAiso plus (Takara, catalogue no. 9108). The concentration and purity of RNA samples were measured with a Nanodrop ND-2000 (Thermo Science, MA, USA). cDNA was synthesized with a Primer Script Reverse Transcriptase Kit (Takara, catalogue no. RR037A). Quantitative real-time PCR was performed using a TB GreenTM Premix Ex Taq Kit (Takara, catalogue no. RR820A) on a LightCycler Real-Time PCR System (Roche, 480II). The primer sequences (Sangon Biotech) are listed in Supplementary Table 3 . The relative amounts of mRNA were calculated using the ΔΔCt relative quantification method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the control gene, and the mRNA levels of specific genes were normalized to GAPDH. Calculations and statistics were done in Microsoft Excel version 16.36; graphs were plotted in GraphPad Prism 8 version 8.4.3.
5
Quantifying Exosomal miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miRNA extracted from PDE was polyadenylated and reverse transcribed into complementary DNA (cDNA) with the miDETECT A Track miRNA qRT-PCR Starter Kit (RiboBio). The miRNA extracted from cells was reverse transcribed using a stem-loop primer, and mRNA was reverse transcribed using a PrimeScript RT Reagent Kit (Takara Bio Inc., Shiga, Japan). The products of reverse transcription polymerase chain reaction (RT-PCR) were used to perform agarose gel electrophoresis. We performed SYBR Green PCR amplification on a real‐time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) using a TB Green Premix Ex Taq kit (Takara Bio Inc.). The relative expression level of exosomal miRNA was normalized to cel-miR-39. After transfection, cell miRNA was normalized to U6 (common control gene), and the cell mRNA was normalized to housekeeping gene glyceraldehyde 3-phospahte dehydrogenase (GAPDH). We calculated the relative expression levels using the equation:
6
Quantitative RT-PCR Analysis of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the 786-O and HK-2 cells was extracted using the Trizol reagent (Ambion, United States) and dissolved in RNase-free ddH2O (Takara Bio, China) under the manufacturer’s instructions. Next, the RNA samples were utilized for generating cDNA using the PrimeScript™ RT Master Mix Kit (Takara Bio, China). Finally, the cDNA samples were employed for qRT-PCR with the TB Green® Premix Ex Taq™ Kit (Takara Bio, China). The amplification was performed using the CFX96 Real-Time system (BIO-RAD, United States). The primers of RRM2, MTHFD2, AGXT2, ALDH6A1, GLDC, HOGA1, ETNK2 and GAPDH were synthesized by Sangon (Sangon Biotech, China), and the sequences are listed in Supplementary Table S10 . GAPDH was applied as an internal control, and the relative expression level of 7 genes was calculated by the 2−ΔΔCT method (Schmittgen and Livak, 2008 (link)). The detailed procedure for qRT-PCR is given in Supplementary Table S11 .
7
Eggshell Gland Transcriptomic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 12 eggshell gland tissues (six hens laying normal eggs and six hens laying speckled eggs) using an RNA extraction kit (Tiangen, Beijing, China) following the manufacturer’s specifications. The mRNA was reversely transcribed into cDNA using a PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Dalian, China). Three DEGs (Due to insufficient samples, we only verified three DEGs, BFSP2, IQSEC, TMOD4) and GAPDH were selected to design primers based on the chicken coding sequence from the NCBI database (Supplementary Table S2 ). GAPDH was selected as the internal control. The qRT-PCR was conducted using the TB Green® Premix Ex Taq™ Kit (Takara, Kusatsu, Japan) with an ABI 7500 system (Applied Biosystems), using the following program: 95 °C for 30 s, 40 cycles of 95 °C for 5 s, 55 °C for 30 s, 72 °C for 30 s. The 2−ΔΔCt method was used to calculate the relative expression level. The R2 between qRT-PCR and RNA-seq was calculated using simple linear regression in R Studio.
8
Gene Expression Analysis via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cells by using TRIzol RNA Isolation Reagents (Thermofisher). cDNAs were synthesized from total RNA with a Hifair II 1st Strand cDNA Synthesis Kit (Yeasen) for qPCR. The qPCR procedure was carried out according to the kit instructions (TB Green Premix Ex Taq kit, TakaRa). Primers used were as follows:
SOX9 F: AGACCTTTGGGCTGCCTTAT
R: TAGCCTCCCTCACTCCAAGA
COL2A1 F: TTTCCCAGGTCAAGATGGTC
R: CTTCAGCACCTGTCTCACCA
ACAN F: AGGCAGCGTGATCCTTACC
R: GGCCTCTCCAGTCTCATTCTC
β-ACTIN F: TGGCACCACACCTTCTACAATGAGC
R: GCACAGCTTCTCCTTAATGTCACGC
SOX9 F: AGACCTTTGGGCTGCCTTAT
R: TAGCCTCCCTCACTCCAAGA
COL2A1 F: TTTCCCAGGTCAAGATGGTC
R: CTTCAGCACCTGTCTCACCA
ACAN F: AGGCAGCGTGATCCTTACC
R: GGCCTCTCCAGTCTCATTCTC
β-ACTIN F: TGGCACCACACCTTCTACAATGAGC
R: GCACAGCTTCTCCTTAATGTCACGC
9
RNA Extraction and Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total RNA extraction kit (Axygen, Sigma‐Aldrich) was used to extract total RNA from the NPCs. The first strand complementary DNA (cDNA) synthesis kit (TAKARA, Beijing, China) was used to reverse transcribe the total RNA to first strand cDNA. Quantitative PCR was performed using the TB‐Green premix Ex Taq kit (TAKARA) system and a QuantStudio 6 Flex real‐time system (Thermo Fisher Scientific). The 2^(−ΔΔCt) and 2^(−ΔCt) methods were used to calculate relative gene expression. β‐actin and GAPDH were used as internal references. Primer sequences were designed using BLAST (NCBI, Bethesda, USA).
Extracted RNA was assayed via RNA (transcriptome) sequencing by Wuhan Huada Gene Technology Co., Ltd. (China) and analyzed for the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, Gene Ontology (GO) cellular components, and mRNA relative expression using fragments per kilobase million (FPKM) on the Mybgi platform (Wuhan Huada Gene Technology,https://mybgi.bgi.com/tech/login ).
Extracted RNA was assayed via RNA (transcriptome) sequencing by Wuhan Huada Gene Technology Co., Ltd. (China) and analyzed for the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, Gene Ontology (GO) cellular components, and mRNA relative expression using fragments per kilobase million (FPKM) on the Mybgi platform (Wuhan Huada Gene Technology,
10
RNA-Seq Analysis of Hippocampus in Aged Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the hippocampus using TRIzol reagent (15596026, Invitrogen). The quality of total RNA was confirmed by agarose gel electrophoresis, and RNA was used for the construction of cDNA library. RNA sequencing (RNA-Seq) was performed in the hippocampus of 18 months old offspring. The sequencing was conducted on an Illumina Nova6000 system and performed by Genergy biological technology Co., Ltd. (Shanghai, China). The reads were trimmed and then mapped to the entire genome. Differential expression genes (DEGs) were determined by fold change > 1 and P value < 0.05. GO and KEGG pathway enrichment analyses were performed. The Venn diagram was drawn online (http://jvenn.toulouse.inra.fr/app/example.html ) (Bardou et al. 2014 (link)).
Total RNA was reverse transcribed using a PrimeScript RT reagent Kit with gDNA Eraser (RR047A, Takara, Japan). The TB green Premix EX Taq kit (RR420A, Takara, Japan) was used for PCR. Quantitative real-time PCR (qRT-PCR) reactions were run on Applied Biosystems QuantStudio 7 Flex PCR systems (Thermo Fisher Scientific Inc.). The primer sequences were listed in Supplementary Table 1 (see section onsupplementary materials given at the end of this article).
Total RNA was reverse transcribed using a PrimeScript RT reagent Kit with gDNA Eraser (RR047A, Takara, Japan). The TB green Premix EX Taq kit (RR420A, Takara, Japan) was used for PCR. Quantitative real-time PCR (qRT-PCR) reactions were run on Applied Biosystems QuantStudio 7 Flex PCR systems (Thermo Fisher Scientific Inc.). The primer sequences were listed in Supplementary Table 1 (see section on
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!