All restriction enzymes used in this study were from (New England Biolabs (NEB), Hitchin, UK). The miR-199a-pre-miRNA oligonucleotides primers (Table 1 A) were annealed and were cloned into the HindIII + EcoRI cut pcDNA3.1 (+) plasmid [15 (link),56 (link)]. 3′UTRs were cloned into psiCHECK-II vectors (Promega, Madison, WI, 53711, USA). SMAD4 and FN1 3′UTRs were amplified with primers as listed in Table 1 B. The amplified PCR fragments were cut with XhoI+NotI and cloned into a psiCHECK-II plasmid that was digested with XhoI + NotI. All other 3′UTRs were amplified by PCR using In-Fusion cloning kit (Clontech Laboratories, Inc. A Takara Bio Company, Mountain View, CA, 95131, USA) and cloned into the PmeI cut site of psiCHECK-II with the In-Fusion cloning kit. Primers used for amplification are shown in Table 1 B. To create mut-RAP2B-3′UTR in the miR-199a-3p seed-complimentary region, the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA 01938-2723, USA) was used with primers that were designed with the NEBaseChanger tool (Table 1 C).
In fusion cloning kit
Manufactured by Takara Bio
Sourced in United States, Japan, China, France
The In-Fusion cloning kit is a molecular biology tool designed for fast and efficient DNA assembly. It enables the seamless joining of multiple DNA fragments, regardless of their origin or method of preparation.
Automatically generated - may contain errors
Lab products found in correlation
Primestar max dna polymerase, by Takara Bio (8 mentions)
Dual luciferase reporter assay system, by Promega (7 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (5 mentions)
Phusion polymerase, by New England Biolabs (4 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (4 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (4 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (3 mentions)
Lipofectamine, by Thermo Fisher Scientific (3 mentions)
Pcdna5 frt to vector, by Thermo Fisher Scientific (3 mentions)
Stellar competent e coli cells, by Takara Bio (3 mentions)
Pcdna3, by Thermo Fisher Scientific (3 mentions)
Fetal bovine serum (fbs), by Merck Group (3 mentions)
Stellar competent cells, by Takara Bio (3 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (3 mentions)
Nebuilder, by New England Biolabs (3 mentions)
Geneticin selective antibiotic g418 sulfate, by Thermo Fisher Scientific (3 mentions)
Hygromycin b, by Thermo Fisher Scientific (3 mentions)
Gblock, by Integrated DNA Technologies (3 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (2 mentions)
341 protocols using in fusion cloning kit
1
Cloning and Mutagenesis of 3'UTRs for miRNA Regulation
2
Cloning and Mutagenesis of ENDOD1 and TP53
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For cloning of Flag-tagged ENDOD1 and TP53, PCR fragments were inserted into the EcoRI site of pLVX-Flag -IRES-ZsGreen1 plasmid, using the In-Fusion cloning kit (Clontech, 639650). Point mutants for ENDOD1 and TP53 were converted from parental pLVX-Flag -IRES-ZsGreen1 plasmids using QuikChange Lightning Site-Directed Mutagenesis Kits (Stratagene, 200519). Truncations of ENDOD1 and mutations of TP53 were obtained by fusing different PCR fragments using In-Fusion cloning kit (Clontech, 639650). Primers used in this study were listed in Supplementary Table 3 .
3
Cloning and Mutational Analysis of Cyclin B3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse Ccnb3 mRNA was amplified by PCR from a whole-testis cDNA library and cloned into pRN3-RFP vectors using the In-Fusion cloning kit (Clontech). X. laevis cyclin B3 cDNA (clone ID: 781186; NCBI ID: 379048 ) was purchased from Dharmacon and used as a template for PCR amplification. D. rerio and D. melanogaster cyclin B3 (NCBI ID: 767751 and 42971 , respectively) were amplified by PCR from cDNA from D. rerio embryo or the S2 cell line, respectively. Amplified products for X. laevis, D. rerio, and D. melanogaster were cloned into pRN3-GFP vector using the In-Fusion cloning kit (Clontech). To generate Ccnb3 MRL mutation, overlapping primers with specific mutation were used to amplify PCR product from the wild-type template pRN3–cyclin B3–RFP, the template was digested by DpnI treatment, and the PCR product was used to transform Escherichia coli DH5α competent cells. To generate the ΔD-box mutation, PCR primers that delete the D-box were used to amplify the Ccnb3 plasmid, and the resulting PCR product was phosphorylated and ligated. The primer list can be found as Table S1. Plasmids for in vitro transcription of cyclin B1–GFP, securin-YFP, histone H2B-RFP, cyclin A2–GFP, and β-tubulin-GFP were used (Brunet et al., 1998 (link); Herbert et al., 2003 (link); Terret et al., 2003 (link); Tsurumi et al., 2004 (link); Touati et al., 2012 (link)).
4
Construction of HopF2-BirA* fusion protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phusion polymerase (New England Biolabs) was used for all cloning and constructs were confirmed by sequencing. We created C-terminally tagged HopF2 to allow the myristoylation site to be accessible (HopF2-BirA*-FLAG-HA, referred as HopF2-BirA*). HopF2 and BirA*-FLAG fragments were amplified from previously described pBBR1 MCS-2 and pDEST5-BirA*-FLAG-pcDNA5-FRT-TO respectively14 (link),35 (link). These fragments were ligated using overlap extension PCR36 (link). Ligated products were cloned into pDB vector at the StuI restriction site with an ATG start codon and in-frame with the C-terminal hemagglutinin (HA) tag using In Fusion Cloning kit37 (link) (Takara Clontech:638909). BirA*-FLAG-HA (referred as BirA*) was also cloned into the pDB vector at the StuI restriction site using In Fusion Cloning kit (Takara Clontech:638909).
5
Cloning SARS-CoV-2 Spike and hACE2 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SARS-Cov-2 Spike (or C terminal Δ19) gene was PCR amplified from the plasmids CHC3-pSFG_SARS-CoV-2 Spike or CHC4- pSFG_SARS-CoV-2 Spike Δ19 [14 ] with forward primer 5’- CTCACGCGTGCCACCATGGAGTTTGGGCTGAGCTGGC-3’ and reverse primer 5’- CTTTACTCATGGTGGACTTATCGTCGTCATCCTTGTAATCTC TAGAAGCG-3’ and were cloned into the pHR-EGFP vector (modified from Addgene plasmid #122147, which was linearized by PCR with forward primer 5’- GATGACGACGATAAGTC CACCATGAGTAAAGGAGAAGAACTTTTCACTG-3’ and reverse primer 5’-CAGCCC AAACTCCATGGTGGCACGCGTGAGAATTCTCG-3’) using the In-Fusion Cloning kit (Takara Bio) to generate CHC17-pHR_SARS-CoV-2 Swt_EGFP (or CHC-18 with Δ19,).
The hACE-2 gene was PCR amplified from the plasmid CHC21-pSFG_hACE-2 with forward primer 5’- GAATTCTCACGCGTGCCACCATGGAGTTTGGGCTGAGCTGGC-3’ and reverse primer 5’- CCTTTAGACACCATGGTGGACTTATCGTCGTCAT CCTTGTAAT CTCTA GAAAAG-3’ and were cloned into the pHR-mCherry vector (modified from Addgene plasmid #101221 which was linearized by PCR with forward primer 5’- CAAGGATGACGACGATAA GTCCACCATGGTGTCTAAAGGCGAGG-3’ and reverse primer 5’- CAGCTCAGCCCAAACTCCATGGTGGCACGCGTGAGAATTCTCG-3’ using the In-Fusion Cloning kit (Takara Bio) to make CHC16-pHR_hACE2_mCherry.
The hACE-2 gene was PCR amplified from the plasmid CHC21-pSFG_hACE-2 with forward primer 5’- GAATTCTCACGCGTGCCACCATGGAGTTTGGGCTGAGCTGGC-3’ and reverse primer 5’- CCTTTAGACACCATGGTGGACTTATCGTCGTCAT CCTTGTAAT CTCTA GAAAAG-3’ and were cloned into the pHR-mCherry vector (modified from Addgene plasmid #101221 which was linearized by PCR with forward primer 5’- CAAGGATGACGACGATAA GTCCACCATGGTGTCTAAAGGCGAGG-3’ and reverse primer 5’- CAGCTCAGCCCAAACTCCATGGTGGCACGCGTGAGAATTCTCG-3’ using the In-Fusion Cloning kit (Takara Bio) to make CHC16-pHR_hACE2_mCherry.
6
CRISPR/Cas9 and Lentiviral Vector Cloning
7
Engineered CRISPR-Cas9 Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT SaCas9 complementary DNA (cDNA) was cut from pX601 plasmid,39 (link) a gift from F. Zhang (Addgene plasmid #61591), using AgeI-HF and BamHI-HF, and subcloned into pLbCpf1-2A-GFP plasmid by replacing LbCpf1,40 (link) generating the pSaCas9-2A-GFP plasmid. Modified SaCas9 sgRNA scaffold and KKH SaCas9 C terminus cDNA (E782K/N968K/R1015H) were synthesized as gBlocks (Integrated DNA Technologies) and subcloned into pSaCas9-2A-GFP plasmid using an In-Fusion cloning kit (Takara Bio), generating the pKKH-SaCas9-2A-GFP plasmid. The sgRNAs targeting human DMD exon 51 or mouse Dmd exon 51 were subcloned into the newly generated pKKH-SaCas9-2A-GFP plasmid using BbsI digestion and T4 ligation. KKH SaCas9, 7SK, and U6 sgRNA expression cassettes were subcloned into the pSSV9 single-stranded AAV plasmid using an In-Fusion cloning kit (Takara Bio). Cloning primer sequences are listed in Table S1 . AAV viral plasmid was column purified and digested with SmaI and AhdI to check inverted terminal repeat (ITR) integrity. AAV was packaged by Boston Children’s Hospital Viral Core, and serotype 9 was chosen for capsid assembly. AAV titer was determined by quantitative real-time PCR assay.
8
Genetic Manipulation and Optimization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All genes were PCR amplified with PrimerSTAR Max DNA Polymerase (TaKaRa Bio). Each gene was assembled with the respective plasmid using In-Fusion Cloning Kit (TaKaRa Bio). Chromosomal in-frame deletions of pobA were individually carried out as reported earlier [18 (link)]. MNX1 from Candida parapsilosis CBS604 and AS from Rauvolfia serpentine were codon optimized and synthesized by Genewiz (Suzhou, China). To substitute gene phzA and phzB with MNX1 and AS, a modified gene deletion version was used to amplify a 400–500 bp DNA fragment of phzA upstream, the open reading frame (ORF) of MNX1, AS and 400–500 bp DNA fragment of phzB downstream, above genes, were cloned into pk18mobsacB using In-Fusion Cloning Kit (TaKaRa Bio).
Other gene deletion or substitution derivatives were constructed in the corresponding strains using a similar method. Plasmid pBBR-MNX1–AS was constructed as follows. First, the gene set of MNX1 and AS was PCR-amplified using pk18-MNX1–AS as the template. The amplified gene set was cloned into pBBR1MCS digested with XhoI and XbaI under the control of Plca promoter. Other candidate genes were similarly cloned into pBBR1MCS, individually. The corresponding accession numbers of nucleotide sequence data were shown in Additional file1 , Table S2.
Other gene deletion or substitution derivatives were constructed in the corresponding strains using a similar method. Plasmid pBBR-MNX1–AS was constructed as follows. First, the gene set of MNX1 and AS was PCR-amplified using pk18-MNX1–AS as the template. The amplified gene set was cloned into pBBR1MCS digested with XhoI and XbaI under the control of Plca promoter. Other candidate genes were similarly cloned into pBBR1MCS, individually. The corresponding accession numbers of nucleotide sequence data were shown in Additional file
9
Cloning SARS-CoV-2 Spike and hACE2 Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SARS-Cov-2 Spike (or C terminal Δ19) gene was PCR amplified from the plasmids CHC3-pSFG_SARS-CoV-2 Spike or CHC4- pSFG_SARS-CoV-2 Spike Δ19 [14 ] with forward primer 5′-CTCACGCGTGCCACCATGGAGTTTGGGCTGAGCTGGC-3′ and reverse primer 5′-CTTTACTCATGGTGGACTTATCGTCGTCATCCTTGTAATCTC TAGAAGCG-3′ and were cloned into the pHR-EGFP vector (modified from Addgene plasmid #122147, which was linearized by PCR with forward primer 5′-GATGACGACGATAAGTC CACCATGAGTAAAGGAGAAGAACTTTTCACTG-3′ and reverse primer 5′-CAGCCC AAACTCCATGGTGGCACGCGTGAGAATTCTCG-3′) using the In-Fusion Cloning kit (Takara Bio) to generate CHC17-pHR_SARS-CoV-2 Swt_EGFP (or CHC-18 with Δ19).
The hACE-2 gene was PCR amplified from the plasmid CHC21-pSFG_hACE-2 with forward primer 5′-GAATTCTCACGCGTGCCACCATGGAGTTTGGGCTGAGCTGGC-3′ and reverse primer 5′-CCTTTAGACACCATGGTGGACTTATCGTCGTCATCCTTGTAATCTCTA GAAAAG-3′ and were cloned into the pHR-mCherry vector (modified from Addgene plasmid #101,221 which was linearized by PCR with forward primer 5′-CAAGGATGACGACGATAA GTCCACCATGGTGTCTAAAGGCGAGG-3′ and reverse primer 5′-CAGCTCAGCCCAAACTCCATGGTGGCACGCGTGAGAATTCTCG-3′ using the In-Fusion Cloning kit (Takara Bio) to make CHC16-pHR_hACE2_mCherry.
The hACE-2 gene was PCR amplified from the plasmid CHC21-pSFG_hACE-2 with forward primer 5′-GAATTCTCACGCGTGCCACCATGGAGTTTGGGCTGAGCTGGC-3′ and reverse primer 5′-CCTTTAGACACCATGGTGGACTTATCGTCGTCATCCTTGTAATCTCTA GAAAAG-3′ and were cloned into the pHR-mCherry vector (modified from Addgene plasmid #101,221 which was linearized by PCR with forward primer 5′-CAAGGATGACGACGATAA GTCCACCATGGTGTCTAAAGGCGAGG-3′ and reverse primer 5′-CAGCTCAGCCCAAACTCCATGGTGGCACGCGTGAGAATTCTCG-3′ using the In-Fusion Cloning kit (Takara Bio) to make CHC16-pHR_hACE2_mCherry.
10
Constructing GUS Reporter Fusions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct ProBOR1;1c (5'-UTR): GUS and ProBOR1;1c (∆5'-UTR): GUS, promoter sequences of BnaC4.BOR1;1c with or without 5'-UTR were ampli ed from 'QY10' DNA by PCR reaction with speci c primers (Table S1), then fused with ScaI and SmaI digested PBI121 fragment using In-Fusion Cloning kits (Clontech). To construct Pro35S 5'UTR: GUS, Pro35S 5'UTR ∆1-29 : GUS, and Pro35S 5'UTR ∆1-97 : GUS, truncated 5' UTR sequences were ampli ed by PCR reaction with speci c primers (Table S1) and were fused with XbaI digested PBI121using In-Fusion Cloning kits (Clontech). To generate Pro35S 5'UTR ∆1-29 : GUS, Pro35S 5'UTR: GUS was used as a template by PCR reaction using speci c primers, and the PCR product was self-fused.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!