Sip53

Manufactured by Santa Cruz Biotechnology

Sourced in United States

Sip53 is a laboratory equipment product offered by Santa Cruz Biotechnology. It is designed to facilitate the detection and analysis of p53 protein, a key regulator of cellular processes. The core function of Sip53 is to provide a reliable tool for researchers studying p53-related pathways and mechanisms.

Automatically generated - may contain errors

Lab products found in correlation

Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Transfectin, by Bio-Rad (2 mentions) Sictr, by Santa Cruz Biotechnology (1 mentions) Miscript target protector, by Qiagen (1 mentions) Pre mir mirna precursor molecules, by Thermo Fisher Scientific (1 mentions) Doxorubicin hydrochloride, by Merck Group (1 mentions) Epidermal growth factor (egf), by Thermo Fisher Scientific (1 mentions) Insulin, by Merck Group (1 mentions) Hydrocortisone, by Merck Group (1 mentions) Cholera toxin, by Merck Group (1 mentions) Sirna transfection reagent, by Santa Cruz Biotechnology (1 mentions) Control sirna, by Santa Cruz Biotechnology (1 mentions) Sip53, by Thermo Fisher Scientific (1 mentions) Sicon, by Santa Cruz Biotechnology (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) Sc 35736, by Santa Cruz Biotechnology (1 mentions) Sictrl sc 37 007, by Santa Cruz Biotechnology (1 mentions)

7 protocols using sip53

Modulating p53 and WWP1 in cancer cell lines

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293(ΔNp63α) [18 (link)] and MDA-MB-231 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Hyclone) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (Hyclone). MCF-10A cells were grown in DMEM/F12 media (Hyclone), supplemented with 20 ng/ml epidermal growth factor (Invitrogen), 100 ng/ml cholera toxin (Sigma), 10 mg/ml insulin (Sigma), 500 ng/ml hydrocortisone (Sigma), 1% penicillin/streptomycin (Hyclone) sulfate and 5% FBS (Hyclone). All cells were cultured at 37°C in a humidified 5% CO2 incubator.
Small interfere RNA (siRNA) for p53 (1#sip53, Santa Cruz, sc-29435; 2#sip53, Santa Cruz, sc-44218) or WWP1 (1#siWWP1, GenePharma [18 (link)]; 2#siWWP1, Santa Cruz, sc-40366) and pre-miR microRNA precursor for microRNA-452 (Ambion, PM12509) [19 (link)] were transfected with Lipofectamine 2000 (Invitrogen) as described in the manufacture’s instruction. 100 pmol of each siRNA or pre-miR was used per well of 6-well plate at 80~90% cell confluence.

Chen J., Shi H., Chen Y., Fan S., Liu D, & Li C. (2017). DNA damage induces expression of WWP1 to target ΔNp63α to degradation. PLoS ONE, 12(4), e0176142.

+ Open protocol

+ Expand

Modulating miR-380-5p and Targetome

Check if the same lab product or an alternative is used in the 5 most similar protocols

miR-380-5p synthetic precursor (pre-miR-380-5p) and the negative control oligomer (preNeg) were purchased as Pre-miR™ miRNA precursor molecules (Thermo Fisher Scientific). miR-380-5p inhibitor (LNA380) and the relative control oligomer (LNANeg) were purchased as miRCURY LNA™ microRNA Inhibitors (Exiqon A/S, Vedbaek, Denmark). Commercially available small interfering RNAs (siRNA) targeting TEP1 (siTEP1), TSPYL5 (siTSPYL5), p53 (sip53) and control siRNAs (siCTR) were obtained from Santa Cruz Biotechnology Inc. (Dallas, TX, USA). Target protector oligomers were purchased as miScript Target Protectors (Qiagen, Hilden, Germany). Doxorubicin hydrochloride was from Sigma-Aldrich (Milano, Italy). The reagents were dissolved in nuclease-free, sterile water, stored at −20 °C and diluted at the appropriate working concentration just before use.

Cimino-Reale G., Gandellini P., Santambrogio F., Recagni M., Zaffaroni N, & Folini M. (2017). miR-380-5p-mediated repression of TEP1 and TSPYL5 interferes with telomerase activity and favours the emergence of an “ALT-like” phenotype in diffuse malignant peritoneal mesothelioma cells. Journal of Hematology & Oncology, 10, 140.

+ Open protocol

+ Expand

Transient Transfection of Mammalian Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

MDA-MB-231 and MCF7 mammary cell lines were transiently transfected in serum and antibiotic-free media using 25 μg of polyethylenimine (PEI) and 12 μg of plasmid DNA, incubated at room temperature for 10 min in base media before being added to the plate. For transfection of HC11 cells, media were changed to serum and antibiotic-free media 4 h prior to transfection. After 4 h, 28 μg of PEI and 12 μg of plasmid DNA were incubated at room temperature for 10 min in base media before being added to the plate. Transfection of HEK-293 cells was performed in full growth media with 25 μg of PEI and 10 μg of plasmid DNA. For all cell lines, transfection reagent was left for 16–18 h.
Transfection of primary mouse cell lines with sip53 (Santa Cruz) and siRNA control (Santa Cruz) was performed using siRNA Transfection Reagent (Santa Cruz) as per the manufacturer’s instructions.

Fifield B.A., Qemo I., Kirou E., Cardiff R.D, & Porter L.A. (2019). The atypical cyclin-like protein Spy1 overrides p53-mediated tumour suppression and promotes susceptibility to breast tumourigenesis. Breast Cancer Research : BCR, 21, 140.

+ Open protocol

+ Expand

Silencing Kpnβ1 and p53 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected using Transfectin (Bio-Rad) and 20 nM si-Kpnβ1 (H-7, sc-35,736, Santa Cruz) or 30 nM si-p53 (sc-29,435, Santa Cruz). Control cells were transfected with the equivalent amount of ctrl siRNA (si-ctrl, sc-37,007, Santa Cruz).

Chi R.P., van der Watt P., Wei W., Birrer M.J, & Leaner V.D. (2021). Inhibition of Kpnβ1 mediated nuclear import enhances cisplatin chemosensitivity in cervical cancer. BMC Cancer, 21, 106.

+ Open protocol

+ Expand

Silencing GADD45α and p53 in Glutamate Toxicity

Check if the same lab product or an alternative is used in the 5 most similar protocols

The role of GADD45α and p53 in mediating glutamate oxidative cytotoxicity is examined using GADD45α-siRNA (siGADD45α) and p53-siRNA (sip53) to selectively silence the GADD45α and p53, respectively. The siGADD45α (catalog no. sc-35439, Santa Cruz, CA), sip53 (catalog no. sc-29436, Santa Cruz), and siRNA negative control (catalog no. sc-37007, Santa Cruz) are purchased from Santa Cruz Biotechnology. HT22 cells are seeded the night before transfection at a density of 30‒50% confluence by the time of transfection. Forty nmol of siGADD45α, sip53, and siRNA negative control are used for transfection using Lipofectamine 2000 (Invitrogen, San Diego, CA) according to the manufacturer’s instructions. Transfected cells are maintained in culture for 2 days before harvesting and further analyses. The efficiency of the siRNA knockdown is determined by Western blot analysis.

Choi H.J., Lee A.J., Kang K.S., Song J.H, & Zhu B.T. (2020). 4-Hydroxyestrone, an Endogenous Estrogen Metabolite, Can Strongly Protect Neuronal Cells Against Oxidative Damage. Scientific Reports, 10, 7283.

+ Open protocol

+ Expand

Modulating Ars2 Expression in Glioblastoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Has-miR-6798-3p mimic (CUACCCCCAUCCCCCUGUAG) and microRNA-scrambled control were purchased from RIBOBIO. shCon, shArs2-1#, and shArs2-2# sequences were inserted into the pLKO.1 vector. Human full-length Ars2 cDNA fragment was subsequently cloned into pCDH-CMV-MCS-EF1-puro vector to construct the overexpression plasmid. miRNA sequences were transfected into cultured cells using Lipofectamine 3000 regant (Invitrogen) according to the manufacturer’s instructions. The shArs2-1#, shArs2-2#, shCon, Ars2 overexpression and vector control (Con) plasmids were transfected into 293FT cells using the Lipofectamine 3000 reagent (Invitrogen), the Lentivirus was infected into glioblastoma cells. After that, the transfected cells were selected with 2–4 μg/mL puromycin for 1 week. p53, p21, and control siRNA (sip53, sip21, and siCon) were purchased from Santa Cruz Biotechnology. siRNA were transfected into U87 and LN229 cells using the Lipofectamine 3000 regent according to the manufacturer’s instructions.

Chen Y., Hu X., Li Y., Zhang H., Fu R., Liu Y., Hu J., Deng Q., Luo Q., Zhang D., Gao N, & Cui H. (2018). Ars2 promotes cell proliferation and tumorigenicity in glioblastoma through regulating miR-6798-3p. Scientific Reports, 8, 15602.

+ Open protocol

+ Expand

Targeted Knockdown of Kpnβ1 and p53

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected using Transfectin (Bio-Rad) and 20 nM si-Kpnβ1 (H-7, sc-35736, Santa Cruz) or 30 nM si-p53 (sc-29435, Santa Cruz). Control cells were transfected with the equivalent amount of ctrl siRNA (si-ctrl, sc-37007, Santa Cruz).

Chi A., Watt P.J.v.d., Wei W., Birrer M.J., & Leaner V.D. (2020). Inhibition of Kpn β 1 Mediated Nuclear Import Enhances Cisplatin Chemosensitivity in Cervical Cancer.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!