Peltier thermal cycler

Total DNA was extracted from the kidneys of mice A, C, D, E, and F with commercially available kits (UltraClean^® Tissue & Cells DNA Isolation kit (MO BIO Laboratories, Inc, USA); DNEasy Tissue and Blood (Qiagen) according to the manufacturers’ instructions. For total DNA extracts from mouse A, a PCR reaction mixture contained the following components with final concentration of 20 mmol/L Tris-HCl (pH 8.5 at 25 °C), 50 mmol/L KCl, 2 mmol/L MgCl₂, 200 µmol/L each dNTP (dATP, dCTP, dTTP and dGTP), 0.5 U of Taq polymerase (Fisher Biotec, Australia) and 0.2 µmol/L each primers specific for murine polyomavirus VP2 protein-coding region [7 (link)] in a final PCR reaction volume of 25 µL. The PCR was run on a Peltier thermal cycler (MJ Research, United States) with the following temperature program: an initial denaturing step at 94 °C for 5 min, then 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s. The PCR products were electrophoretically separated in 2% agarose E-gels (Invitrogen, Australia) and visualized with UV light [6 (link)].
A broad-spectrum papillomavirus PCR was performed on DNA extracts from mice C, D, E, and F, according to the method described in Forslund et al. (1999) [8 (link)]. Multiply primed rolling circle amplification was also performed on these same samples, following the method of Rector and co-authors (2004, 2005) [3 (link),9 (link)].

Total RNA was extracted from cell pellets using an Isolate II RNA Mini Kit (Bioline), following the manufacturer's instructions. RNA was quantified using a Nanodrop 1,000 Spectrophotometer (Thermo Fisher Scientific). Five hundred nanograms of isolated RNA was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems), following the manufacturer's protocol using a Peltier thermal cycler (MJ Research). cDNA was then stored at −20 °C.
Gene expression was quantified using a Rotor-gene Q real-time PCR cycler (Qiagen) with SYBR green or TaqMan chemistry. Quantification was achieved using delta CT values normalized to either U6 or B2M. Each reaction was performed in triplicate. The standard thermal cycle settings for a reaction consisted of 40 cycles (each 95 °C for 10 s, 60 °C for 15 s and 72 °C for 20 s), including a melt curve analysis (when using SYBR green).
Taqman (inventoried, Thermo Fisher Scientific, UK) and SYBR green primers (designed in-house, purchased from Sigma-Aldrich) were used, as seen in Supplementary Table S3.

Total RNA (1000 ng) from kidneys was reverse transcribed with High Capacity cDNA Reverse Transcription kit (Life Technologies) using a Peltier Thermal Cycler (MJ Research, Canada). Thermocycler settings were 25°C for 10 min, 37°C for 2 hrs, then 85°C for 5 min. RT PCR was performed on the kidney cDNA using Assays on Demand primer/probesets (Life Technologies). PCR parameters were as follows: Stage 1 = 50°C for 2 min; Stage 2 = 95°C for 10 min; Stage 3 = 95°C for 15 sec then 60°C for 1 min (40 cycles). Fold changes were calculated as described above. 36b4 primer/probeset from Operon, AL (forward primer = ggcccgagaagacctcctt, reverse primer = tcaatggtgcctctggagatt, probe = [6-Fam]ccaggctttgggcatcaccacg[TamraQ]) was used as housekeeping gene to normalize.

Total RNA was extracted from cell pellets using the Isolate II RNA Mini Kit (Bioline, London, UK) RNA Extraction Kit following manufacturer’s instructions. RNA was quantified using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Cambridge, UK). Five hundred nanograms of isolated RNA was reverse‐transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) following manufacturer's protocol using a Peltier thermal cycler (MJ Research, San Diego, CA, USA). cDNA was then stored at −20 °C.
Gene expression was quantified with a Rotor‐Gene Q Real‐time PCR cycler (Qiagen, Manchester, UK) using TaqMan chemistry. Quantification was calculated using delta CT values normalized to B2M. Each reaction was performed in triplicate. All reactions were performed in total volumes of 10 μL loading 500 ng of cDNA. The standard thermal cycle settings for a reaction consisted in 40 cycles including a melt curve analysis (when using SYBR Green). One cycle consisted of 95 °C for 10 s, 60 °C for 15 s and 72 °C for 20 s. TaqMan probes were bought from Thermo Fisher Scientific and corresponded to IL‐1α (Hs: 00174092), IL‐1β (Hs: 01555410_m1), IL‐6 (Hs: 00985639), IL‐8 (Hs: 00174103) and B2M (Hs: 4325797).

Detection of CRKP genes for CRKP isolates was conducted by conventional in-house polymerase chain reaction (PCR) using primers targeting 11 bla_KPC variants. The forward (KPC-F 5′-GCCGTCTAGTTCTGCTGTCTTG-3′) and reverse primers (KPC-R 5′-GCCCAATCCCTCGAGCGCG-3′) detecting KPC-1 to KPC-11 were designed using Vector NTI and GeneDoc software. BLAST program searches were performed using the National Center for Biotechnology Information website to check the specificity of the primer designed (4 (link)). The detection of other resistant genes, namely bla_SME, bla_IMI, bla_IMP, bla_NDM, bla_VIM, and bla_OXA, was done using published primers (14 (link)–18 (link)). DNA was isolated from bacterial colonies using the boiling lysis method as previously recommended (19 (link)). Internal control (hemM: 519-bp) was incorporated in each reaction for validation. The PCR was run using a Peltier thermal cycler (MJ Research, Watertown, Massachusetts, USA). PCR products were detected by an agarose gel electrophoresis and visualized by UV transilluminator (Alpha Innotech, San Leandro, CA, USA). PCR products were sent for DNA sequencing and compared with existing databases by multiple-sequence alignment using the BLAST program.

Polymerase chain reaction (PCR) based on sex determination was performed to identify the presence of sex region y gene (SRY) for males or alanine aminotransferase-1 gene (ALT1) for females. The sequences of primers for SRY were 5′-CAT​GAA​CGC​ATT​CAT​CGT​GTG​GTC-3′, 5′-CTG​CGG​GAA​GCA​AAC​TGC​AAT​TCT T-3′ and 5′-CCC​TGA​TGA​AGA​ACT​TGT​ATC​TC-3’, and 5′-GAA​ATT​ACA​CAC​ATA​GGT​GGC​ACT-3′ for ATL1 (Settin et al., 2008 (link)). Each PCR reaction comprised 100 ng DNA, 1X PCR buffer minus Mg, 0.2 mM dNTP mixture, 1.5 nM MgCl2, 0.5 µM SRY and ALT1 primers (FWD and REV), and 2.5 units Taq DNA Polymerase (5 U/µl) (Invitrogen, Waltham MA, United States). All PCR reactions were performed in a thermal cycler (PTC-225, Peltier Thermal Cycler, MJ Research, NH, United States) at 94°C (3 min) for initial DNA denaturation, followed by 35 cycles of 94°C (15 s) for DNA denaturation, 55°C (30 s) for primer annealing and 72°C (90 s) for primer extension, with a final extension of the cycle at 72°C (10 min). The amplified PCR products were separated on a 2.5% agarose gel with ethidium bromide and imaged under UV transillumination. The product size of SRY was 254 bp for the Y chromosome and ALT1 was 300 bp for the X chromosome. Two product bands at 254 bp and 300 bp identified male samples and one band at 300 bp female samples.