X tremegene hp dna transfection reagent
X-tremeGENE HP DNA Transfection Reagent is a lipid-based transfection reagent designed for efficient delivery of DNA into a variety of cell types. It facilitates the uptake of DNA into cells during transfection experiments.
Lab products found in correlation
17 protocols using x tremegene hp dna transfection reagent
LKB1 Overexpression Protocol
Stable miR-345 Overexpression and Inhibition
siRNA Targeting of NCBP1, CUL4B, NCBP3
Lentiviruses encoding NCBP1, NCBP1‐shRNA (sh‐NCBP1) and control shRNA (sh‐NC) were obtained from HanBio Biotechnology Co., Ltd. shRNA sequences are shown below. Cells were transfected at 50% confluence with a final lentivirus multiplicity of infection (MOI) of 20 for shRNAs. siRNA target sequences were as follows: NCBP1 (#1: 5′‐CCACAGATGATTGCTGTACTA‐3′, #2: 5′‐CAGGAACGGCACATCCTAAGA‐3′); NCBP2: 5′‐GCCAUGCGGUACAUAAAUG‐3′; NCBP3: 5′‐AAGAGCCGGTTAGATAACTTA‐3′; CUL4B: 5′‐GCCACGTACCGATACAGAAGA‐3′; shRNA target sequences were as follows: NCBP1 (#1: 5′‐ATGACTATGTATGCTGACGAA‐3′, #2: 5′‐CAGATTGAAGTTAGTCGGGAA‐3′).
Differential Display Transfection Assay
HNRNP A1 siRNA for knockdown in HFFs (
Manipulating ACYP2, PMCA4, and PTP1B expression
Open reading frame (ORF) of ACYP2 with stop codon was amplified and then cloned into pcDNA3.1(−) mammalian expression vector, termed pcDNA3.1(−)-ACYP2. The primer sequences were shown in Additional file
Overexpression and Knockdown of IGF1R
Oligonucleotides of siRNA targeting IGF1R (si-IGF1R) and control siRNA (si-NC) were purchased from RiboBio Co., Ltd. (Guangzhou, P. R. China). Cells were transfected with a final siRNA concentration of 80 nmol/L with X-tremeGENE siRNA Transfection Reagent (Roche Diagnostics GmbH, Mannheim, Germany). The sequences of siRNA were presented in Supplementary Table
Macrophage Differentiation and Genetic Manipulation
Immunofluorescence Assay for FMDV Type O Detection in BHK-21 Cells
Estrogen Receptor Transcriptional Assay
Constructing NCOA3 Expression Plasmid
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!