The largest database of trusted experimental protocols

Luna universal qrt pcr master mix

Manufactured by New England Biolabs
Sourced in Germany, Austria

Luna Universal qRT-PCR Master Mix is a high-performance, ready-to-use reaction mix for quantitative reverse transcription polymerase chain reaction (qRT-PCR) applications. It contains all the necessary components, including reverse transcriptase and DNA polymerase, for efficient and sensitive RNA detection and quantification.

Automatically generated - may contain errors

6 protocols using luna universal qrt pcr master mix

1

Insect-Borne Bacterial and Phytoplasma Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ninety-one individual insects, from three locations, were analyzed: thirty-six adults and thirty-six nymphs from potato fields, as well as nine adults and ten nymphs from sugar beet fields. Following DNA extraction, as described above, TaqMan qRT-PCR was performed using Luna Universal qRT-PCR Master Mix (New England Biolabs, Frankfurt, Germany), 25 ng of template DNA, and primer pairs KL437/438 and KL464/465, for the detection of Arsenophonus and stolbur, respectively [7 (link)]. The number of target copies was determined using absolute standard curves. Samples with a CT value > 35 were considered negative, which is equivalent to 22 copies for Arsenophonus and 14 copies for stolbur.
To assess the abundance of infected potato and sugar beet plants in two locations, 30 symptomatic sugar beet root samples and 45 symptomatic potato tuber samples were collected, from three locations, and tested for Arsenophonus and stolbur. DNA extracts were prepared from 0.1 g tuber or sugar beet root samples, using a modified CTAB method [26 ] followed by qRT-PCR, as described above.
+ Open protocol
+ Expand
2

Quantitative Analysis of Cell Death Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR analyses of transcripts from BAX, Caspase 3, BCL-2 and CRLF3 were run using specific primers (see oligonucleotide list Table 1). The housekeeping gene (HKG) ß-Actin was used as reference. All primers were analyzed for their efficiencies previously. All samples were loaded in triplicates and (-) RT controls and water were run as negative controls on each plate. qPCRs reactions were prepared with final concentrations of 5 μL Luna® Universal qRT-PCR Master Mix (New England Bio-Lab; #M3003), 0.1 mM forward and reverse primers and 10 ng cDNA. qPCRs were pipetted in a 96-well clear well plates (StarLab; #E1403-5200) and run using a Bio-Rad CFX Connect Real-Time system (Bio-Rad; #1855201).
Ct values were analyzed using the Pfaffl method (Pfaffl, 2001 (link)) and data was normalized to the corresponding HKG value of each sample and further to the corresponding gene of interest (GOI) control value. Relative gene expression data is represented as Bar plots showing the geometric mean and standard deviations.
+ Open protocol
+ Expand
3

Quantification of Deformed Wing Virus

Check if the same lab product or an alternative is used in the 5 most similar protocols
For absolute viral load, quantitative polymerase chain reactions (qPCRs) were performed for DWV in a Bio‐Rad C1000 Thermal Cycler (Bio‐Rad). Reactions were set up using 1x Luna Universal qRT‐PCR master mix (New England Biolabs), 0.25 μM forward and reverse primers and 100 ng of cDNA in a final volume of 20 μL. The DWV forward primer was 5′ATATAGGTTCGGCTGGATCTCC 3′ and the reverse primer was 5′TTCCAGATGCACCACACATGC 3′, amplifying a region of 150 bp in the helicase. Amplification was performed using the following thermal profile: 1 min at 95°C, followed by 40 cycles of 15 s at 95°C and 30 s at 60°C. Negative template controls and a serial dilution of a positive control standard were included in each run. DWV genome equivalents were calculated from the standard curve generated from a serial dilution of a cDNA clone control obtained from 1 μg of DWV VVD RNA transcript as per (Gusachenko, Woodford, Balbirnie‐Cumming, Ryabov, et al., 2020 (link)), with a linear range of 103–1010 GE/μg.
+ Open protocol
+ Expand
4

Quantitative RT-qPCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from organ or cell lysates was isolated and purified using RNeasy Plus Micro Kit. Following the manufacturer’s instructions, cDNA was prepared with the high-capacity cDNA reverse transcription kit (Applied Biosystems). The list of gene targets and catalog numbers used throughout the study can be found in Table S1. Singleplex qRT–PCR protocol was performed using Luna Universal qRT-PCR Master Mix (New England Biolabs). Target gene expression cycle thresholds were normalized to the housekeeping gene and calculated into relative expression using the 2−ΔΔCq method (73 (link)).

Table S1 RT–qPCR reagent information used throughout the study. Predesigned probes and customized primer/probe sets for mRNA gene expression assays.

+ Open protocol
+ Expand
5

Quantifying Gene Expression in Fatty Acid Uptake

Check if the same lab product or an alternative is used in the 5 most similar protocols
To confirm the expression of selected genes of interest involved in fatty acid uptake regulation, RT-qPCR experiments were performed. Fully differentiated Caco-2 cells were starved for 60 min with serum-free medium followed by incubation with the test compounds for 30, 60 and 90 min at 37 °C. Afterwards, RNA was isolated using Monarch® Total RNA Miniprep Kit (New England Biolabs) and reverse-transcribed to cDNA using LunaScript® RT SuperMix Kit (New England Biolabs) according to the manufacturer's protocol. PCR was subsequently performed using Luna® Universal qRT-PCR Master Mix (New England Biolabs) on a Step-One Plus Device (Applied Biosystems, Thermo Fisher Scientific, Austria). The primer pairs used during the PCR can be found in Table S1. Primers not previously reported, namely for DPP4, GCG, GLP1R, GIP and GIP-R, were validated by sequencing the obtained PCR product (Sanger Sequencing, Eurofins, Germany). Gene expression is given as fold change compared to the corresponding control. The starting concentrations of the respective mRNA used for reverse transcription were calculated using LinRegPCR Version 2021.2 and compared to the corresponding control after normalization to HPRT1 and GAPDH as reference genes.
+ Open protocol
+ Expand
6

qRT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was generated
from RNA (1.6 μg)
using SuperScript IV First-Strand Synthesis System (Invitrogen). Each
qRT-PCR reaction (20 μL) contained cDNA (5 ng) as template and
the appropriate primer pairs (0.4 μM; Table S1C). Samples were analyzed in technical duplicates. Amplicons
were detected with Luna Universal qRT-PCR Master Mix (New England
Biolabs) in a CFXConnect Real-Time PCR Instrument (Bio-Rad Laboratories). Cq values were calculated using LinRegPCR85 (link) after correcting for amplicon efficiency. Cq values of technical duplicates were typically
within ±0.25 of each other. holB, which encodes
DNA polymerase III, was used as reference gene. Its transcription
levels were verified to remain constant in the experimental conditions
tested here.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!