N cadherin

Total RNA was extracted from Cal‐27 and SCC‐25‐vector (it represented SCC25 and Cal‐27 cell lines which transfected with empty vector virus as blank control group) and Cal‐27 and SCC‐25‐EphrinA3‐RNAi cells (it represented SCC25 and Cal‐27 cell lines constructed after the virus which can knockdown the EFNA3 gene was transferred) and Cal‐27 and SCC‐25‐EphrinA3‐mimics (it represented the SCC25 and Cal‐27 cell lines which overexpressed the protein EphrinA3) using TRIzol reagent (Invitrogen, Carlsbad, USA). Gene‐specific primers employed for cDNA amplification were synthesized as follows: EphrinA3 forward, 5′‐GACCTTCTGGCACATACTAACTACACC‐3′ and reverse, 5′‐CAGGCTTGAGGCTACTGATGGTAAC‐3′; E‐cadherin forward, 5′‐AGTCACTGACACCAACGATAAT‐3′ and reverse, 5′‐ATCGTTGTTCACTGGATTTGTG‐3′; N‐cadherin forward, 5′‐CGATAAGGATCAACCCCATACA‐3′ and reverse, 5′‐TTCAAAGTCGATTGGTTTGACC‐3′; β‐actin forward, 5′‐CATTAAGGAGAAGCTGTGCT‐3′ and reverse, 5′‐GTTGAAGGTAGTTTCGTGGA‐3′ (Sangon Biotech, Shanghai, China). Relative levels of EphrinA3, E‐cadherin and N‐cadherin were determined after normalization with an endogenous control β‐actin and calculated from the standard curve. All real‐time RT‐PCR tests were performed in triplicates. The comparative Ct method was used for the final results.

PEG hydrogels were prepared from 8-arm PEG maleimide (hexaglycerol) (PEG-MAL, 10 kDa, JenKem Technology) backbone and 8-arm PEG thiol (hexaglycerol) (PEG-SH, 10 kDa, JenKem Technology) crosslinker. RGD peptides (GCGYGRGDSSPG) for fibronectin, and HAVDI (HAVDIGGGC) or scrambled HAVDI control (AGVGDHIGC) peptides for N-cadherin (Sangon Biotech, Shanghai) were covalently conjugated to the PEG-MAL backbone via Michael addition reactions between the cysteine residues on these peptides and the maleimide on the PEG-MAL backbone. PEG-MAL (5 mM) and peptides were dissolved in phosphate-buffered saline (PBS) for 1 h at 37 °C for peptide conjugation. For these studies, all peptides were used at a final concentration of 1 mM in hydrogels (except for hydrogel control without any peptide conjugation).

MHCC-97H and SMMC-7721 HCC cells were planted in 6-well dishes, and DMEM containing 10% of different concentrations (L, M, H) of BJJP or sorafenib serum were used for 24 h of incubation. The total RNA of these cells was then extracted using TransZol UP Plus RNA Kit (TransGen Biotech; China; ER501-01) as specification and the concentration and purity of the RNA were detected using NanoDrop™ Lite (Thermo Fisher Scientific, Waltham, MA, United States). Total RNA was reverse transcribed into cDNA by PrimeScript™ RT reagent Kit with gDNA Eraser (RR047a, Takara, Japan). According to the instruction of SYBR^® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820a, Takara, Japan), the threshold cycle (Ct) was recorded by Light Cycler® 96 System (Roche Applied Science, Germany). 2^−△△CT method was used to calculated the fold changes of mRNA expression. Data were standardized to the GAPDH control and the primer of GAPDH was brought from Sangon Biotech (Shanghai) Co., Ltd. Primers of Snail, E-cadherin, N-cadherin, as well as Vimentin were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and were shown in Table 1.