Biomark real time pcr analysis software

Manufactured by Standard BioTools

Sourced in United States

The BioMark Real-Time PCR Analysis software is a data analysis tool designed to work with the BioMark HD System. It provides automated data processing and analysis capabilities for real-time PCR experiments performed on the BioMark HD System.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Real-Time PCR Analysis software (82 citations) BioMark Real-time PCR Analysis (13 citations) Real-Time PCR Analysis (6 citations) BioMark Real-Time PCR Analysis Software Version 2.0 (3 citations) BioMark PCR analysis software (2 citations) BioMark Real-Time PCR Analysis Software v2.0 (2 citations) BioMark Real-Time PCR Analysis Software 4.1.3 (2 citations) BioMark Real-Time PCR Analysis Software 3.1.2 (2 citations)

16 protocols using biomark real time pcr analysis software

Single-Cell Multiplex qRT-PCR on Fluidigm Platform

Check if the same lab product or an alternative is used in the 5 most similar protocols

Multiplex qRT–PCR was performed using the Fluidigm (BioMark) platform. TaqMan probes (ThermoFischer) (see Supplementary Data 5) were pooled to a concentration of 0.2×. Before cell sorting, an RT-PreAmp master mix (consisting of 5 µl 2× Reaction Buffer and 1.2 µl RT/Taq enzyme (ThermoFischer SuperScript III One-Step RT-PCR System with Platinum Taq kit), 0.1 µl SUPERase-In RNAse Inhibitor (Ambion), 1.2 µl TE buffer (Invitrogen), and 2.5 µl of 0.2× TaqMan assay mix) was freshly prepared on the day. All pipetting steps were performed in a clean-room.
Hundred cells were directly sorted by FACS into 10 µl of RT-PreAmp master mix. Collected samples were immediately vortexed and spun to aid cell lysis. RT-PCR (15 min at 50 °C; 2 min at 95 °C) and pre-amplification (15 s at 95 °C and 4 min at 60 °C; 20 cycles) was performed in a PCR machine and diluted with 40 µl TE buffer. The pre-amplified mix was immediately frozen at −20 °C until further analysis. Gene expression analysis was performed using a 48.48 IFC chip (Fluidigm) according to the manufacturer’s instructions. Ct thresholds were set for each assay with the same thresholds used across all experiments. Ct values were calculated by BioMark Real-time PCR Analysis software (Fluidigm). Data were exported to Excel as.csv files for subsequent analysis.

Bonkhofer F., Rispoli R., Pinheiro P., Krecsmarik M., Schneider-Swales J., Tsang I.H., de Bruijn M., Monteiro R., Peterkin T, & Patient R. (2019). Blood stem cell-forming haemogenic endothelium in zebrafish derives from arterial endothelium. Nature Communications, 10, 3577.

+ Open protocol

+ Expand

High-throughput Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

A high-throughput gene expression platform based on microfluidic dynamic arrays (Fluidigm, USA) was used to perform ChIP-qPCR and RT-qPCR. The resultant DNA was pre-amplified using TaqMan PreAmp MasterMix (Applied Biosystems, USA) following the manufacturer’s protocol. Following pre-amplification, samples were diluted 1:5 in TE buffer (pH 8.0). BioMark 48 × 48 arrays were prepared following the manufacturer’s protocol. After the IFC controller loaded assays and samples into the chip, PCR was performed under the following conditions: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Data were processed in BioMark Real-time PCR Analysis software (Fluidigm), through automatic threshold setting (same value for all assays) and linear baseline correction. Data from ChIP-qPCR and RT-qPCR were normalized to input DNA and ACTB expression, respectively.
Mean qPCR data from three independent reactions were visualized using PCA and heatmaps in the Galaxy browser (www.galaxy.psu.edu) and MeV^{52 (link)}, respectively.

Hayakawa K., Nishitani K, & Tanaka S. (2019). Kynurenine, 3-OH-kynurenine, and anthranilate are nutrient metabolites that alter H3K4 trimethylation and H2AS40 O-GlcNAcylation at hypothalamus-related loci. Scientific Reports, 9, 19768.

+ Open protocol

+ Expand

Single-cell mRNA profiling of neural cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A TaqMan assay pool was prepared by adding each of the 48 TaqMan assays (20×; Applied Biosystems) to a final concentration of 0.2× for each assay. Neurospheres were dissociated and single cells were sorted by fluorescence-activated cell sorting (FACS) directly into 10 μL of RT-PreAmp Master Mix (5 μL CellsDirect 2× Reaction Mix [Invitrogen], 2.5 μL 0.2× Assay pool, 0.5 μL SuperScript^® III RT/Platinum^® Taq mix [Invitrogen], and 2 μL TE buffer). Cells were frozen at −80°C and thawed to induce lysis. Sequence-specific reverse transcription (50°C for 20 min) and reverse transcriptase inactivation (95°C for 2 min) were performed to generate complementary DNAs (cDNAs) of the 48 genes, following which sequence-specific preamplification (18 cycles at 95°C for 15 s and 60°C for 4 min) was performed. The preamplified cDNA was diluted 5-fold and used for single-cell mRNA profiling in 48.48 dynamic arrays on a BioMark system (Fluidigm). Single-cell mRNA profiling was run using the BioMark Data Collection software (Fluidigm) and Ct values were calculated using the BioMark Real-time PCR analysis software (Fluidigm). Cells with Ct value for the endogenous control β-actin between 15 and 25 were considered for analysis. Ct values for a specific cell were normalized to the endogenous control by subtracting the Ct value of β-actin for the same cell. The assumed baseline Ct value is 31.

Yu Y.H., Narayanan G., Sankaran S., Ramasamy S., Chan S.Y., Lin S., Chen J., Yang H., Srivats H, & Ahmed S. (2015). Purification, Visualization, and Molecular Signature of Neural Stem Cells. Stem Cells and Development, 25(2), 189-201.

+ Open protocol

+ Expand

CD34+ cell expansion and single-cell analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD34⁺ cells from human umbilical cord blood were cultured in expansion culture medium for 7 days in the presence of TNFSF15 at 37°C with 5% CO₂. Then the cells were collected, respectively, and stained with APC‐conjugated anti‐CD34 (BD; 555824), PE.Cy7‐conjugated anti‐CD38 (BD; 560677), APC.Cy7‐conjugated anti‐CD45RA (BD; 560674), PerCP.Cy5.5‐conjugated anti‐CD90 (BD; 561557) and PE‐conjugated anti‐CD49f (BD; 555736) antibodies for 30 minutes at room temperature in dark. Then 50 CD34⁺CD38⁻CD45RA⁻CD90⁺CD49f⁺ cells were sorted into a mixture of CellsDirect 2× Reaction Mix, 0.2× TaqMan Assay Mix (Applied Biosystems) and SuperScript III RT/ PlatinumTaq Mix (Invitrogen). Total RNA was extracted with CellsDirect One‐Step qRT‐PCR Kit (Invitrogen) according to the manufacturer's instructions. Reverse transcription and specific target amplification were performed continuously with the following parameters: 50°C for 15 minutes, 95°C for 2 minutes, 95°C for15 s for 18 cycles and 60°C for 4 minutes. Pre‐amplified cDNA was diluted with TE buffer (1:5), and PCR assay was performed. Data were analysed using BioMark Real‐Time PCR Analysis Software (Fluidigm).

Ding Y., Gao S., Shen J., Bai T., Yang M., Xu S., Gao Y., Zhang Z, & Li L. (2020). TNFSF15 facilitates human umbilical cord blood haematopoietic stem cell expansion by activating Notch signal pathway. Journal of Cellular and Molecular Medicine, 24(19), 11146-11157.

+ Open protocol

+ Expand

Single-cell qPCR Analysis of Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ninety-six individual primer sets were pooled to a final concentration of 0.1 μM for each primer as described^{29 (link)}. After 7 days of culture, 96 single cells were randomly picked from cultures incubated with control or the combination of CHIR-99021, Forskolin and OAC1 conditioned medium and sorted into 8-well PCR strips loaded with 5 μL RT-PCR Master Mix (Vazyme) in each well. Sorted strips were immediately frozen at –80 °C and immediately placed into the PCR machine after brief centrifugation. The PCR progress was identical to the multi-cell one-step PCR but with 20 cycles of sequence-specific amplification. After pre-amplification, PCR strips were stored at –80 °C to avoid evaporation. Pre-amplified products were diluted by 5-fold and analyzed with EvaGreen 2 × qPCR MasterMix (Applied Biological Materials, Vancouver, Canada), 20 × DNA Binding Dye (Fluidigm, San Francisco, CA, US) and individual qPCR primers using 96.96 Dynamic Arrays on a BioMark System (Fluidigm). Threshold crossing (Ct) values were calculated using the BioMark Real-Time PCR Analysis software (Fluidigm).

Jiang M., Chen H., Lai S., Wang R., Qiu Y., Ye F., Fei L., Sun H., Xu Y., Jiang X., Zhou Z., Zhang T., Li Y., Xie J., Fang Q., Gale R.P., Han X., Huang H, & Guo G. (2018). Maintenance of human haematopoietic stem and progenitor cells in vitro using a chemical cocktail. Cell Discovery, 4, 59.

+ Open protocol

+ Expand

Quantitative PCR data normalization

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate assay efficacy, Ct values were calculated using the BioMark Real-Time PCR Analysis software (Fluidigm). Ct values between 40 and 24 corresponded to detectable expression levels and values < 24 represented quantifiable expression levels. Ct values were normalized to those of endogenous controls by subtracting average CCCTC-binding factor (CTCF) and TATA-binding protein (TBP) expression levels, using OmicSoft™ software (Qiagen). The most stable reference genes for normalization were identified using a geNorm test on qbase⁺ software (qPCR analysis). A second normalization was performed using a common experimental control sample in the three experiments to correct potential technical qPCR bias. The OmicSoft™ Array viewer version 10.0.1.96 software was used for normalization, and -ΔCt was represented using boxplots according to the median, standard deviation of groups, and heatmaps.

Chabrat A., Lacassagne E., Billiras R., Landron S., Pontisso-Mahout A., Darville H., Dupront A., Coge F., Schenker E., Piwnica D., Nivet E., Féron F, & Mannoury la Cour C. (2019). Pharmacological Transdifferentiation of Human Nasal Olfactory Stem Cells into Dopaminergic Neurons. Stem Cells International, 2019, 2945435.

+ Open protocol

+ Expand

Fluidigm Screening of nt230(del4) MDR1 Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

nt230(del4) MDR1 mutation was screened using the Fluidigm BioMark apparatus (Fluidigm Corporation US) with an Assay-specific TaqMan fluorescence probe mix. The probe sequences, which were designed following NC_006596.3, are as follows: VIC Probe Sequence was ATGACAGATAGCTTTGCAA (wt), FAM Probe Sequence AACATGACAGCTTTGCAAA (mutant); the forward and reverse primers are CCATCATCCATGGAGCTGC and CACAAATAATACTTACTTTCATTAATTATAACTGG, respectively, amplicon size 133 bp. Assay along with PCR master mix were run in duplicate by loading 5 μl into each well of the primed 96.96 Fluidigm Chip. The chip was then placed in the integrated fluidic circuit controller and loaded before analysis with the BioMark reader. The following thermal cycling protocol was used: 50°C (2 min), 70°C (30 min), 25°C (10 min), 50°C (2 min), and 95°C (4 min). This was followed by 40 cycles of 95°C (10 s) and 61°C (30 s). The initial cycle [50°C (2 min), 70°C (30 min), 25°C (10 min)]. Data were analyzed and cycle threshold (CT) values were determined using BioMark real-time PCR analysis software (Fluidigm Corp.), and automated mutation calling was carried out using an algorithm based on the change in CT (DCT) values between the wild-type and the mutant.

Dekel Y., Machluf Y., Stoler A., Aderet A., Baumel D., Kellerman E., Plotsky Y., Noked Partouche O., Elhalal G., Ben-Shlomo I, & Bercovich D. (2017). Frequency of canine nt230(del4) MDR1 mutation in prone pure breeds, their crosses and mongrels in Israel - insights from a worldwide comparative perspective.. BMC Veterinary Research, 13, 333.

+ Open protocol

+ Expand

Single-Cell Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolated from BM cells was amplified before analysis by qPCR using the SybrGreen (Applied Biosystems) method. Freshly sorted single cells or 200 cell mixtures were preamplified with TaqMan Assay Mix (Applied Biosystems) and then processed on 96:96 Fluidigm Dynamic Arrary IFCs with a BioMark HD system and then analyzed using BioMark Real-Time PCR Analysis Software (Fluidigm).
See Supplemental Experimental Procedures for details, antibodies, and primers.

Qiu J., Papatsenko D., Niu X., Schaniel C, & Moore K. (2014). Divisional History and Hematopoietic Stem Cell Function during Homeostasis. Stem Cell Reports, 2(4), 473-490.

+ Open protocol

+ Expand

Single-Cell qPCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pre-amplified products were diluted five-fold prior to analysis. Amplified single-cell samples were analyzed with Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), EvaGreen Binding Dye (Biotium, Hayward, CA, USA) and individual qPCR primers using 96.96 Dynamic Arrays on a BioMark System (Fluidigm, South San Francisco, CA, USA). Three dynamic arrays loaded with different primer sets were used for each sample plate. Ct (threshold cycle) values were calculated using the BioMark Real-Time PCR Analysis software (Fluidigm).

Saadatpour A., Guo G., Orkin S.H, & Yuan G.C. (2014). Characterizing heterogeneity in leukemic cells using single-cell gene expression analysis. Genome Biology, 15(12), 525.

+ Open protocol

+ Expand

Multiplex RT-qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Extraction of total RNA was performed using the RNAqueous Total RNA Isolation Kit (Ambion) following the manufacturer's recommendations. Reverse transcription was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). High throughput multiplex real-time qPCR studies were carried out using BioMark dynamic arrays (Fluidigm) and run on the BioMark Real Time qPCR system (Fluidigm). RT-qPCR data were normalized to the invariant control genes RPS6 or GAPDH, and analyzed using the 2–∆∆Ct method. Heatmaps have been generated using the BioMark Real Time PCR Analysis software (Fluidigm). The following TaqMan primer/probe sets were used: (human, HOG-EGC) GAPDH Hs02786624_g1, PTGES: Hs01115610_m1, PTGES2: Hs00228159_m1, PTGES3: Hs04187819_g1, PTGS1: Hs00377726_m1, PTGS2: Hs00153133_m1, TGFB1: Hs00998133_m1, EGF: Hs01099999_m1, JAG1: Hs01070032_m1, RSPO1: Hs00543475_m1, NOG: Hs00271352_s1, FGF2: Hs00266645_m1, EPCAM: Hs00158980_m1, S100B: Hs00902901_m1, SOX10: Hs00366918_m1; (rat, JUG-EGC) Rps6: Rn00820815_g1, S100b Rn00566139_m1, Sox10: Rn00569909_m1, Gfap: Rn00566603_m1, Plp1: Rn00456892_m1.

Valès S., Bacola G., Biraud M., Touvron M., Bessard A., Geraldo F., Dougherty K.A., Lashani S., Bossard C., Flamant M., Duchalais E., Marionneau-Lambot S., Oullier T., Oliver L., Neunlist M., Vallette F.M, & Van Landeghem L. (2019). Tumor cells hijack enteric glia to activate colon cancer stem cells and stimulate tumorigenesis. EBioMedicine, 49, 172-188.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!