Transfected cells harvested at day three were prepared for PCR by pelleting and resuspending in PCR-safe lysis buffer (10 mm Tris·Cl, pH 8.0; 2 mM EDTA; 2.5% (vol/vol) Tween-20; 2.5% (vol/vol) Triton X-100; 100 μg mL−1 proteinase K) at ∼1000 cells per μL, followed by incubation at 50 °C for 60 min and 95 °C for 15 min. Typically, 1 μL of prepared lysate was used in a 2× AccuStart II PCR SuperMix (QuantaBio); all other applications were according to the manufacturer’s protocol. Gene modification in individual colonies was detected by RFLP analysis and direct sequencing of PCR amplicons, characterized by TOPO cloning (Invitrogen) and sequencing.
Accustart 2 pcr supermix
Manufactured by Quantabio
Sourced in United States
AccuStart II PCR SuperMix is a ready-to-use solution for real-time PCR amplification. It contains all the necessary components, including DNA polymerase, dNTPs, MgCl2, and buffers, to perform reliable and sensitive PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Topo cloning, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Perfecta sybr green fastmix rox, by Quantabio (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Roche (2 mentions)
T100 thermocycler, by Bio-Rad (2 mentions)
Extracta dna prep for pcr tissue, by Quantabio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Molecular imager fx, by Bio-Rad (1 mentions)
Nextera adapter, by Illumina (1 mentions)
Nextera xt index kit, by Illumina (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Extracta dna prep kit, by Quantabio (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Sanger sequenced, by Eurofins (1 mentions)
E z n a insect dna kit, by Omega Bio-Tek (1 mentions)
17 protocols using accustart 2 pcr supermix
1
Cell Lysis and PCR Analysis
2
PCR-based Gene Modification Analysis
3
Mitochondrial DNA Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MtDNA copy number, conformation, and integrity were evaluated in total and mitochondrial DNA extracted from tissue samples.48 (link), 49 (link) In brief, mtDNA copy number was determined by real time-PCR using primers and Taqman probes for mitochondrial and NDUVF1 and the AccuStartII PCR supermix (QuantaBio). The respective primer sequences are summarized in Table S6 . To quantify the levels of existing mtDNA strand breaks, mitochondrial DNA and free 3′ ends were labeled in vitro using radioactive incorporation of dCTP by terminal deoxynucleotide transferase. 0.5 μg of purified mtDNA was incubated with 5 μCi dCTP (3000 Ci/mmol) and 7.5 U terminal deoxynucleotidyl transferase (TdT) in 30 μL 1× TdT buffer at 37°C for 30 min and separated over a 1% Tris-borate-EDTA (TBE)/agarose gel containing 0.1 μg/μL ethidium bromide. Equal loading was confirmed by UV visualization, the gel was Southern blotted onto Hybond-XL membrane, and the intensity of each lane was quantified by phosphor imaging (Molecular Imager FX, Bio-Rad). The abundance of replication intermediates was visualized using Brewer/Fangman 2D neutral/neutral agarose electrophoresis. MtDNA deletions were detected by long-range PCR as previously described50 (link) and visualized by Phosporimager.
4
Bacterial 16S rDNA Amplification from Skin Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplification of the V3-V4 region of bacterial 16S rDNA obtained from the skin samples was carried out with primers that contained overhang Illumina Nextera adapters (341F:5’-TCGTCGGCAGCGTCAGATGTG TATAAGAGACAGCCTACGGGNGGCWGCAG −3’ and 805R: 5’- TCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC −3’). The 25 µL PCR mixture contained 10 ng of DNA template, 0.2 µM of each primer, and AccuStart™ II PCR SuperMix (Quantabio, USA). Amplification of this reaction was conducted under the following conditions: 98 ℃ for 2 min, 25 cycles of 98 ℃ for 20s, 60 ℃ for 30s, 72 ℃ for 30s, and 72 ℃ for 1 min. A second PCR was then carried out to attach the multiplexing indices and Illumina adapters using the Nextera XT Index Kit (Illumina, USA) in line with the regular protocol. The final overall length of the DNA library reached 580 bp, allowing examination using 2% agarose gel electrophoresis, followed by purification using AMPure XP beads (Beckman Coulter, USA).
5
Validating Gene Modification in Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Validation of gene modification was performed after fibroblast transfection. Cells were lysed in PCR-safe lysis buffer (10 mM Tris·HCl, pH 8.0; 2 mM EDTA; 2.5% (vol/vol) Tween 20; 2.5% (vol/vol) Triton X-100; 100 μg/mL proteinase K) and incubated for 1 h at 55°C and 15 min at 95°C. PCR used 1 μL of prepared lysate in Accustart II PCR Supermix (QuantaBio) according to the manufacturer’s instructions. Gene editing in colonies was detected by direct Sanger sequencing of PCR amplicons. DNA was isolated from harvested tissues using DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol.
6
Genotyping Protocol for Cdk5rap2 Mutant Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNAs were extracted from mice using the Extracta DNA prep kit (Quantabio, Edmonton, AB. Canada). Tissue samples were added to 50–100 µl of extraction buffer, incubated at 95 °C for 30 min, and stabilized with an equal volume of stabilization buffer. DNA sample (1 µl) was added to 10 µl of Quantabio’s AccuStart II PCR SuperMix containing 100 nM of the appropriate DNA primers. The forward primers used were: GAAACCAGGGTGACA GGTACA (wt Cdk5rap2) and AGATGTCATGTCTAAAGCAATCACT (an Cdk5rap2). The reverse primer used was the same for the wt and an reactions: CCTTTGTCTTTCTGCCCTGA. Based on the expected size of each fragment, the wt Cdk5rap2 allele corresponds to a 581 bp band whereas the mutant an Cdk5rap2 allele corresponds to a 500 bp band. The reaction mixtures were input into a Bio-Rad thermocycler using PCR settings recommended by the Jackson Laboratory.
7
RNA Extraction and Quantitative PCR
8
Borrelia burgdorferi RNA Isolation and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Borrelia burgdorferi RNA was isolated using hot phenol chloroform extraction as previously described (Lybecker et al., 2014 (link); Lybecker and Henderson, 2018 (link)). Total RNA was treated with DNaseI (Roche) and 1 μg was converted to cDNA using SuperScript III reverse transcriptase (+ RT) (Thermo Fisher) according to the manufacturer’s instructions. A no RT control was included for each RNA sample. PCR reactions using 500 ng cDNA as template were amplified with AccuStart II PCR Supermix (Quantabio) and imaged on a 1% agarose gel. Quantitative RT-PCR (qRT-PCR) reactions were performed from in vitro cultivated samples with 50 ng + RT and −RT cDNA using a ViiA 7 Real-Time PCR system (Applied Biosystems) and Fast SYBR Green Master Mix (Applied Biosystems) according to the manufacturer’s instructions. B. burgdorferi co-culture transcript experiments were performed using PerfeCTa SYBR Green FastMix ROX (Quantabio) and StepOnePlus Real-Time PCR system (Applied Biosystems). flaB was used as an internal control and fold change relative to wild type (WT) calculated using the 2–ΔΔCT method from three to four biological and technical replicates (Livak and Schmittgen, 2001 (link)).
9
Genomic DNA Extraction and 18S Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA was extracted from a single specimen using E.Z.N.A.® Insect DNA kit (Omega, Bio-Tek, Norcross, GA, USA) by following the manufacturer’s instructions and quantified with a Nanodrop 2000 (Thermo Scientific, Austin, TX, USA). To perform species identification, 18S primers targeting the V4 region were used (TAReuk454FWD1 and TAReukREV3) (Macrogen, Seoul, Korea) [15 (link)].
PCR reactions were performed on samples using the AccuStart II PCR SuperMix (Quanta bio, Beverly, MA, USA), and following the touch-down thermal cycle: initial denaturation 94 °C for 3′; 10 cycles with denaturation at 94 °C for 20″, annealing at 57 °C for 30′ and elongation at 72 °C for 1′, then 25 cycles with denaturation at 94 °C for 20″, annealing at 47 °C for 30″ and elongation at 72 °C for 1′. Each PCR reaction was performed in a final volume of 20 μL, with a final concentration of 1 X supermix, 0.4 μM of each primer and 1 μL of DNA (average DNA concentration 22 ng/µL).
PCRs were sent to an external service to be Sanger sequenced (Eurofins, Hamburg, Germany). The consensus sequence obtained has been deposited at GenBank under accession number MN982880.
PCR reactions were performed on samples using the AccuStart II PCR SuperMix (Quanta bio, Beverly, MA, USA), and following the touch-down thermal cycle: initial denaturation 94 °C for 3′; 10 cycles with denaturation at 94 °C for 20″, annealing at 57 °C for 30′ and elongation at 72 °C for 1′, then 25 cycles with denaturation at 94 °C for 20″, annealing at 47 °C for 30″ and elongation at 72 °C for 1′. Each PCR reaction was performed in a final volume of 20 μL, with a final concentration of 1 X supermix, 0.4 μM of each primer and 1 μL of DNA (average DNA concentration 22 ng/µL).
PCRs were sent to an external service to be Sanger sequenced (Eurofins, Hamburg, Germany). The consensus sequence obtained has been deposited at GenBank under accession number MN982880.
10
Plant DNA Extraction and Molecular Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from 40 to 100 mg fresh leaves (Actinidia species) or 20 to 80 mg wood chips (Lonicera species) using Omega Bio-Tek’s E.Z.N.A. Plant DNA kit (#D2411-00) as per manufacturer’s instructions. matK was amplified with AccuStart II PCR SuperMix (QuantaBio #89235-018) and primers 5′–CGTACAGTACTTTTGTGTTTACGAG–3′ and 5′–ACCCAGTCCATCTGGAAATCTTGGTTC–3′ (250 nM final concentration) [50 (link)] using the following program: 3 min at 95 °C, 40× (30 s at 95 °C, 40 s at 60 °C, 60 s at 72 °C), and 5 min. at 72 °C. rbcL was amplified with AccuStart II and primers 5′–ATGTCACCACAAACAGAAAC–3′ and 5′–TCGCATGTACCTGCAGTAGC–3′ [50 (link)] using the following program: 1 min. at 94 °C, 35× (10 s at 94 °C, 20 s at 60 °C, 45 s at 70 °C). The psbA – trnH intergenic spacer was amplified using primers 5′–GTTATGCATGAACGTAATGCTC–3′ and 5′–CGCGCATGGTGGATTCACAATCC–3′ [51 (link)] as described for rbcL. After DNA cleanup using NEB’s Monarch PCR Cleanup kit (#T1030G), the amplicons of approximately 450–800 bp were Sanger sequenced using the forward and reverse primer. T-Coffee [52 (link)] was used to align the sequences and the consensus sequence was used to identify the species using NIH’s nucleotide BLAST.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!