Total RNA was extracted from 1 × 106Leishmania-infected BMDMs (MOI 10) using TRIzol reagent (Invitrogen). Contaminating DNA was removed with an RNase-free DNase set (Promega). cDNA was synthesized from 1 μg of RNA using the SuperScript II reverse transcriptase (Invitrogen). Subsequent real-time PCR was performed on an AI PRISM 7000 sequence detector (Applied Biosystems) using SYBR Green (Invitrogen). The following primer sequences were used: HPRT forward (5′- TCAGTCAACGGGGGACATAAA-3′), reverse (5′-AAGCCATGCCAATGTTGTCT-3′), Tnfa forward (5′-TGTGCTCAGAGCTTTCAACAA-3′), reverse (5′-CTTGATGGTGGTGCATGAGA-3′) and Nos2 forward (5′-CGAAACGCTYCACTTCCAA-3′), reverse (5′- GGGGCTGTACTGCTTAACCAG –3′). The mRNA expression levels were normalized to HPRT. The adjusted values were calculated using the following formula: 2−(CT target − CTHPRT), where CT is the cycle threshold. The fold change in the expression was calculated as the n-fold difference in expression in the infected cells compared to the uninfected cells.
Rnase free dnase set
Manufactured by Promega
Sourced in United States
The RNase-free DNase set is a laboratory product designed to remove DNA from RNA samples. It provides a reliable and effective way to eliminate DNA contamination, ensuring the purity of RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Ai prism 7000 sequence detector, by Thermo Fisher Scientific (2 mentions)
Sybr green, by Thermo Fisher Scientific (2 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Bio-Rad (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Stratagene mx3000p qpcr machine, by Agilent Technologies (1 mentions)
Easy blue total rna extraction kit, by iNtRON Biotechnology (1 mentions)
Biophotometer, by Eppendorf (1 mentions)
Rneasy mini kit, by Promega (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
6 protocols using rnase free dnase set
1
Quantifying Leishmania-induced Transcripts
2
Quantification of mRNA Expression by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the mRNA expression levels, total cellular RNA was extracted using TRIzol reagent (Invitrogen) and then treated with RNase free DNase Set (Promega, Madison, MI, USA) according to manufacturer’s instructions. Reverse transcription reactions were performed with 2 μg total RNA using the SuperScript First-Strand Synthesis System (Invitrogen), according to the manufacturer’s instructions. Real-time PCR (Bio-Rad, Hercules, CA, USA) was performed with 1 μL of the single-stranded cDNA sample with SYBR Green PCR master mix (Bio-Rad). The sequences of primers used were listed in Table 1 . The qPCR program started at 95°C for 3 min followed by 40 cycles of 95°C, 10s and 60°C, 30s. Each amplification reaction was checked to confirm the absence of nonspecific PCR product by melting curve analysis. The relative gene expression level was calculated and presented with the 2-ΔΔCt method. GAPDH was used as a reference gene to normalize specific gene expression in each sample.
3
Canine CD20 Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from lymph nodes samples of the cNHL biobank and lymph node samples and PBMCs from the control group using Rneasy Mini Kit (Qiagen). To eliminate possible contaminant DNA, total RNA samples were subjected to DNAse treatment, using RNase-free DNase Set (Promega; Wood Hollow road, Madison, USA.), following the manufacturer’s instructions24 (link). Thereafter, First-strand cDNA was synthesized using Transcriptor High Fidelity (Roche) following the manufacturer’s instructions and used as a template for RT-PCR using primers presented in Table 1 , designed at the ends of reported sequence of canine CD20. Sequencing was performed by Eurofins Genomics (Ebersberg, Germany). Translation to amino acid sequences, multiple sequence alignment and phylogenetic analysis were performed using the “Vector NTI” software. Sequence alignments were processed using the “ALINE” software.
4
RNA Extraction and qRT-PCR Analysis of V. vulnificus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from V. vulnificus using the easy-BLUE™ total RNA extraction Kit (iNtRON Biotechnology, Seongnam, Korea) and treated with the RNase-free DNase set (Promega, Madison, WI, United States) to remove any residual DNA. The purified RNA was quantified using a Biophotometer (Eppendorf, Hamburg, Germany). Subsequently, cDNA was synthesized from 500 ng of RNA using the CellScript™ All-in-One cDNA Master Mix (Cellsafe, Yongin, Korea) following the manufacturer’s instructions. One microliter of cDNA was used for RT-PCR analysis on a Stratagene Mx3000p qPCR machine (Agilent Technologies, Santa Clara, CA, United States) using QGreenBlue 2 × Green qPCR Master Mix (Cellsafe, Yongin, Korea). The RT-PCR reactions were performed in triplicate in a 96-well plate using primer shown in Supplementary Table S2 . The PCR conditions used to amplify all genes were: 10 min at 95°C and 40 cycles of 95°C for 15 s and 64°C for 40 s. The genes encoding type I glyceraldehyde-3-phosphate dehydrogenase (RS_10395) and DNA-directed RNA polymerase subunit alpha (RS_13660) of V. vulnificus were used as endogenous loading controls. Quantification was carried out using the Light Cycle 480 II real-time PCR system software program.
5
Extraction and Quantification of Liver Cancer Cell RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the liver cancer cells was extracted using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.), which was then treated with an RNeasy Mini kit and RNase-free DNase Set (Promega Corp., Madison, WI, USA) according to the manufacturer's protocols. The primers used in the PCR reactions were as follows: RAD54B forward, 5′-GCCAAACACTGATGATTTGTGG-3′ and reverse, 5′-CCTGAGAAGAATGCGAGATAGC-3′; GAPDH forward, 5′-TGACTTCAACAGCGACACCCA-3′ and reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3′. GAPDH was used as the internal control. The fold amplification for gene expression was determined using the 2−∆∆Cq method (17 (link)).
6
Quantifying Leishmania-induced Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 1 × 106Leishmania-infected BMDMs (MOI 10) using TRIzol reagent (Invitrogen). Contaminating DNA was removed with an RNase-free DNase set (Promega). cDNA was synthesized from 1 μg of RNA using the SuperScript II reverse transcriptase (Invitrogen). Subsequent real-time PCR was performed on an AI PRISM 7000 sequence detector (Applied Biosystems) using SYBR Green (Invitrogen). The following primer sequences were used: HPRT forward (5′- TCAGTCAACGGGGGACATAAA-3′), reverse (5′-AAGCCATGCCAATGTTGTCT-3′), Tnfa forward (5′-TGTGCTCAGAGCTTTCAACAA-3′), reverse (5′-CTTGATGGTGGTGCATGAGA-3′) and Nos2 forward (5′-CGAAACGCTYCACTTCCAA-3′), reverse (5′- GGGGCTGTACTGCTTAACCAG –3′). The mRNA expression levels were normalized to HPRT. The adjusted values were calculated using the following formula: 2−(CT target − CTHPRT), where CT is the cycle threshold. The fold change in the expression was calculated as the n-fold difference in expression in the infected cells compared to the uninfected cells.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!