P3 solution

The gRNAs were designed using a free online tool (Deskgen). The two gRNA sequences used for TG2 KO were 'GTCTTGCTGGTCCACCACGG' and 'TGAGGCGATACAGGCCGATG' which both target exon 3 in the TGM2 gene. For SMAD3 gene deletion the cells used in this study and the gRNA sequence used to achieve gene editing of Smad3 was ‘GAGCTGACACGGAGACACAT’ as published by Martufi et al. with only a single RNA electroporation performed using the method described in the same paper (Martufi et al. 2019 (link)). Briefly, the gRNA was diluted in nuclease-free duplex buffer at 25 µM before boiling at 95 °C for 5 min and then cooling for a further 10 min at RT. The RNA (72.5 pmol) was then complexed with the Cas9 enzyme (60 pmol) and incubated at RT for 10 min before adding 60 pmol of electroporator enhancer and incubating for a further 5 min at RT. IPF fibroblasts (2.5 × 10⁵ cells) were then washed with PBS, pH 7.4, before being pelleted by centrifugation at 90 × g for 10 min. The cells were re-suspended in 15.5 µl P3 solution (Lonza, UK) and then 4.5 µl of the gRNA complex was added. The electroporation was performed in 16-well Nucleocuvette strips. The IPF fibroblasts were then plated into a 24-well plate and incubated in a 37 °C, 10% CO₂-humidified incubator for 24 h. The next-generation sequencing and analysis was performed by Matteo Martufi (GlaxoSmithKline).

ATP5G1^L32P NPCs were generated using the dCas9 base editor, ABEmax (gift from David Liu, Addgene #112095), as previously described (Koblan et al., 2018 (link)). Briefly, a synthetic sgRNA (TCCTCTAGTCTATTCAGGAA) was selected by manual inspection of the AGS Atp5g1 sequence for a PAM (NGG) site near the desired edit on the (-) strand of the gene. AGS NPCs were nucleofected (Amaxa 4D, program DS113) in P3 solution (Lonza, Alpharetta, GA, USA) containing pCMV ABEmax (500 ng/200,000 cells). Following a 48 hr recovery period, the same cells were nucleofected with the synthetic sgRNA sequence above (100 pmol, Synthego, Menlo Park, CA, USA). Cells were expanded and then clonally plated. Clones were screened by PCR as the desired base edit also introduced a new BfaI restriction enzyme cutting site. Sanger sequencing was used to confirm the two WT and three KI clone sequences utilized. Potential off-target effects of CRISPR/Cas9 cleavage were analyzed by Sanger sequencing of the top 5 predicted off-target genomic locations [https://mit.crispr.edu], which demonstrated a lack of indels for all clones used in subsequent analysis.

Candidate genes were tagged endogenously within parasites using the CRISPR/Cas9 system which has been adapted for use in Toxoplasma (49 (link), 50 (link)). Briefly, genes were tagged just prior to the endogenous stop codon following guide selection from EuPaGDT (http://grna.ctegd.uga.edu/batch_tagging.html). The CRISPR target plasmid (made by Q5 mutagenesis [NEB]) was cotransfected with homologous repair constructs containing Ty or HA epitope tag as previously described (21 (link)). Two oligonucleotides with at least 30 bp of complementarity at their 3′ end, usually over the HA or TY epitope, were annealed together in IDT-duplex buffer by heating to 98°C for 2 min and then gradually allowed to cool (49 (link)). Ten micrograms of Cas9 plasmid was combined with the total 80 μg of annealed oligonucleotides and resuspended in 20 μl P3 solution (Lonza) in an Amaxa 4D Nucleofector (Lonza) using the code FI-115 (Human Unstimulated T-cells). Human foreskin fibroblasts (HFF) were grown to confluence in Dulbecco’s modified Eagle medium (DMEM), supplemented with 10% Cosmic Calf serum (HyClone), and refreshed with DMEM with 1% fetal calf serum when inoculated with parasites.