Ti3C2Tx (MXene) few layer dispersion solution (Lateral size 2–5 µm), Fe3O4 nanoparticles, TiO2 nanoparticles, bulk Ti3AlC2 and WS2 nanosheets (Diameter 2–5 µm) were obtained from Jiangsu XFNANO Materials Tech. Co., Ltd. (Nanjing, China). MoS2 nanosheets (Diameter 20–500 nm) were obtained from Nanjing JCNANO Tech. Co., Ltd. (Nanjing, China). NH2-Fe3O4 and Nafion solutions were obtained from Aladdin Biochemical Tech. Co., Ltd. (Shanghai, China). Gold chloride (HAuCl4∙4H2O), sodium citrate, 6-mercaptohexanol (MCH), 1-naphthyl phosphate (1-NPP), 1-naphthol, streptavidin–alkaline phosphatase (SA-ALP), 4-nitrophenol, β-estradiol and diethanolamine (DEA) were purchased from Sigma-Aldrich Chemical (St. Louis, USA). Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) was purchased from Sangon Biotech. Co., Ltd. (Chongqing, China). Nt.BsmAI nicking endonuclease (Nt.BsmAI) and CutSmart buffer were provided by New England Biotech. Co., Ltd. (Beijing, China). All high-performance liquid chromatography (HPLC)-purified sequences (Additional file 1 : Table S1) in our experiments were ordered from Sangon Biotech. Co., Ltd. (Shanghai, China). Clinical serum samples were obtained from the University-Town Hospital of Chongqing Medical University (Chongqing, China). The buffers and solutions involved in this experiment were display in Additional file 1 : S1.
6 mercaptohexanol mch
Manufactured by Merck Group
Sourced in United States, Germany
6-mercaptohexanol (MCH) is a laboratory chemical that serves as a functional group. It contains a thiol (-SH) group attached to a hexanol (C6H13OH) molecule. MCH is commonly used in various chemical synthesis and analysis applications in research and development settings.
Automatically generated - may contain errors
Lab products found in correlation
Tris 2 carboxyethyl phosphine hydrochloride tcep, by Merck Group (2 mentions)
Tyramine, by Merck Group (2 mentions)
Absolute ethanol, by Avantor (2 mentions)
1 dodecanethiol, by Merck Group (2 mentions)
Sodium hydroxide (naoh), by Avantor (2 mentions)
1 naphthol, by Merck Group (1 mentions)
Diethanolamine dea, by Merck Group (1 mentions)
Tris 2 carboxyethyl phosphine hydrochloride tcep, by Sangon (1 mentions)
4 nitrophenol, by Merck Group (1 mentions)
β estradiol, by Merck Group (1 mentions)
Sodium citrate, by Merck Group (1 mentions)
Acetone, by Merck Group (1 mentions)
N 3 dimethylaminopropyl n ethylcarbodiimide hydrochloride edc, by Merck Group (1 mentions)
N hydroxysuccinimide, by Merck Group (1 mentions)
Bisphenol a, by Merck Group (1 mentions)
Neb buffer, by New England Biolabs (1 mentions)
Nb bbvci, by New England Biolabs (1 mentions)
Tris 2 carboxyethyl phosphine hydrochloride solution, by Merck Group (1 mentions)
Hydrofluoric acid, by Merck Group (1 mentions)
Human blood serum, by Merck Group (1 mentions)
10 protocols using 6 mercaptohexanol mch
1
Nanomaterial-Enhanced Electrochemical Biosensor
2
Gold-based Nanomaterial Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gold chloride trihydrate (HAuCl4·xH2O), sodium citrate, and potassium persulfate (K2S2O8) were obtained from Aladdin Biochemical Technology Co. Ltd. (Shanghai, China). g-C3N4 were obtained from Jiangsu XFNANO Materials Tech, Co. Ltd. (Nanjing, China). Tris (4,4′-dicarboxylic acid-2,2′-bipyridyl) ruthenium (II) dicbloride (Ru (dcbpy)3Cl2) was obtained from Suna Tech Inc. (Suzhou, China). Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) and 6-mercaptohexanol (MCH) were obtained from Sigma-Aldrich (St Louis, MO, USA). The purified DNA sequences (Table S1 ) were synthesized from Genscript Bio-technology Co. Ltd. (Nanjing, China).
3
Oligonucleotide Immobilization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two complementary single-stranded 30-mer oligonucleotides: capture probe, 5′-GAGTAAAGTTAATACCTTTGCTCATTGACG-3′; and target probe, 3′-CTCATTTCAATTATGGAAACGAGTAACTGC-5′ were obtained from Integrated DNA Technologies, Inc. (Leuven, Belgium). Tyramine, N-hydroxysuccinimide (NHS), N-(3-dimethylaminopropyl) N-ethylcarbodiimide hydrochloride (EDC), 6-mercaptohexanol (MCH) and 1-dodecane thiol were obtained from Sigma-Aldrich (Steinheim, Germany), while sodium hydroxide and absolute ethanol (99.8%) were obtained from VWR international (Leuven, Belgium). Regeneration solution and buffers were prepared in ultrapure water (Millipore purification system, Bedford, MA, USA), filtered through a membrane with pores of 0.22 μm and degassed prior to use.
4
Molecular Detection of MRSA via Electrochemical DNA Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 25-mer mecA gene probe was designed from S. aureus subsp. aureus MRSA252 mecA gene sequence, retrieved from the National Center for Biotechnology Information (NCBI) database [12 (link)] as shown in Table 1 . The probes were purchased from Integrated DNA Technologies, Inc. (Leuven, Belgium). Human saliva was collected from one of the authors of this work. Absolute ethanol and sodium hydroxide were obtained from VWR international (Radnor, USA). Tyramine (99 %), acetone, N-hydroxysuccinimide (NHS), N-(3-dimethylaminopropyl) N-ethylcarbodiimide hydrochloride (EDC), 6-mercaptohexanol (MCH), and 1-dodecane thiol were obtained from Sigma-Aldrich (Steinheim, Germany). All other chemicals used were of analytical grade. All buffers and regeneration solutions were prepared in ultrapure water (Millipore purification system, Massachusetts, USA). All solutions were filtered through a membrane (pore size 0.22 μm) and degassed prior to use.Table 1
DNA probes used in this study.
| Name of probe | Sequence (5'→3') (25-mer) |
|---|---|
| Capture probe(CP) | GCTCAGGTACTGCTATCCACCCTCA |
| Complementary probe (TP) | TGAGGGTGGATAGCAGTACCTGAGC |
| Single-base mismatched probed (SMT) | TGAGGGTGGAT |
| Two-base mismatched (TMT) | TGAGGGTGGAT |
| Twelve-base mismatched probe (12 M T) | T |
| Non-complementary probe (NC) | ACTCCCACCTATCGTCATGGACTCG |
5
Analytical Reagents for Biophenol Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisphenol A (BPA), ampicillin (Amp), tyrosine (Tyr), tetracycline (Tet), arginine (Arg), 6-mercaptohexanol (MCH), and tris-(2-carboxyrthyl) phosphine hydrochloride (TCEP) were purchased from Sigma. 4,4′-Dihydroxybiphenyl (BP) and bisphenol S (BPS) were purchased from J&K Chemical (Beijing, China). Oxytetracycline (Oxy) and synthesized DNA oligonucleotides were ordered from Sangon Biotech (Shanghai, China). Reagents with analytical grade were used in all experiments. Solutions in experiments were prepared by ultrapure water from Elga Labwater system (Purelab Ultra Genetic Type, Lane End, UK).
6
Colorimetric Detection of SARS-CoV-2 RdRp Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gold chloride trihydrate (HAuCl4·3H2O), sodium citrate, potassium persulfate (K2S2O8) and sodium borohydride (NaBH4) were obtained from Aladdin Biochemical Technology Co. Ltd. (Shanghai, China). Ti3C2 dispersion liquid and g-C3N4 were obtained from Jiangsu XFNANO Materials Tech, Co. Ltd. (Nanjing, China). Tris (4,4′-dicarboxylic acid-2,2′-bipyridyl)ruthenium (II) dichloride (Ru(dcbpy)3Cl2) was obtained from Suna Tech Inc. (Suzhou, China). Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) and 6-mercaptohexanol (MCH) were gained from Sigma-Aldrich (St Louis, MO, USA). Nb.BbvCI and 10 × NEB buffer were obtained from New England Biolabs (USA). The purified DNA sequences (Table S1) were synthesized by Genscript Bio-technology Co. Ltd. (Nanjing, China). Real human sera were collected from healthy volunteers at the Jiangyuan Hospital affiliated with Jiangsu Institute of Nuclear Medicine. And the medical ethical approval procedure was followed in the recovery experiment of SARS-CoV-2 RdRp assay, and consent was obtained from the subjects.
7
Probe Immobilization and Target Hybridization Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An aqueous solution containing 1 μM of probe (5′-GGT CAG ATC GTT GGT GGA GT-3′) (PNA Bio, CA) was mixed with 10 μM of aqueous Tris(2-carboxyethyl)phosphine hydrochloride solution (Sigma-Aldrich, MO) and then the mixture was left for overnight to cleave disulphide bonds. After mixing 100 nM of 6-mercaptohexanol (MCH) (Sigma-Aldrich, MO) to this probe solution mixture, 20 μl was pipetted onto the chips and incubated for 3 h in a dark humidity chamber at room temperature for probe immobilization. The chips were then washed thrice for 5 min with 0.1 × PBS (Life Technologies, CA) at room temperature. The chips were then treated with 1 mM MCH for an hour at room temperature for back filling. After washing, the chips were challenged with different concentration of targets for 30 min at room temperature. After hybridization, the chips were washed thrice for 5 min with 0.1 × PBS at room temperature and the electrochemical scans were acquired.
8
Aptamer-Based SARS-CoV-2 Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Silver nitrate (>99%), hydrofluoric acid (50%), hydrogen peroxide (34%), nitric acid (70%), sulfuric acid (97%), 6-mercaptohexanol (MCH), and cysteamine hydrochloride were purchased from Sigma-Aldrich (Germany). All reagents were of analytical grade and used without further purification. Phosphate-buffered saline solution (PBS, 10 mM) was prepared by dissolving the required amounts of KCl, NaCl, K2HPO4, and KH2PO4 in deionized water.
All the solutions were prepared using deionized water produced by a Millipore system. The 5′-thiolated anti-N specific DNA aptamer (5′-aaa aac gcg cgt att cct tag ggg cac cgc tac acg cgc g-3′) was acquired from Biomers (Germany). The sequence was purified by HPLC to ensure the maximum purity and the reproducibility of the test. This DNA aptamer was recently discovered by Zhang et al. for the targeting of recombinant COVID-19 nucleocapsid protein of SARS2-CoV-2.27 (link) Membrane protein (M protein) and recombinant SARS-CoV-2 spike glycoprotein (S protein) were purchased from Abcam. The human blood serum used in this work was purchased from Sigma-Aldrich (product ref. H4522).
All the solutions were prepared using deionized water produced by a Millipore system. The 5′-thiolated anti-N specific DNA aptamer (5′-aaa aac gcg cgt att cct tag ggg cac cgc tac acg cgc g-3′) was acquired from Biomers (Germany). The sequence was purified by HPLC to ensure the maximum purity and the reproducibility of the test. This DNA aptamer was recently discovered by Zhang et al. for the targeting of recombinant COVID-19 nucleocapsid protein of SARS2-CoV-2.27 (link) Membrane protein (M protein) and recombinant SARS-CoV-2 spike glycoprotein (S protein) were purchased from Abcam. The human blood serum used in this work was purchased from Sigma-Aldrich (product ref. H4522).
9
Electrochemical G-Quadruplex Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the DNAs were provided by Shanghai Sangon Biotechnology (Shanghai, China); a thrombin aptamer (TBA 15) was used as a “nanoclaw” and integrated into the input strands Ca and Cb. Thrombin (TB) and 6-mercaptohexanol (MCH) were purchased from Sigma Aldrich (USA). Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) was purchased from Bio Basic Inc (Markham Ontario, Canada). K3Fe[CN]6 and K4Fe[CN]6 were obtained from Xilong Chemical Co. Ltd. (Guangdong, China). NMM (N-methyl mesoporphyrin IX, a kind of porphyrin dye that could generate an enhanced fluorescence signal after binding with G-quadruplex) was provided by J&K (Beijing, China). Tris–HCl S-buffer (20 mM Tris, 100 mM NaCl, 5 mM TCEP, pH 7.4) was used to dissolve SH-DNA. Tris–HCl M-buffer (20 mM Tris, 2 mM MCH, pH 7.4) was applied to block the electrode and decrease nonspecific adsorption. Tris–HCl W-buffer (5 mM Tris, pH 7.4) acted as the washing buffer. Other DNAs were dissolved with 1× HEPES buffer (25 mM HEPES, 10 mM KCl, 100 mM NaCl, pH 7.4). Distilled water was purified using a Millipore system.
10
Electrochemical Aptasensor for Cardiac Biomarker Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Carbon fiber paper (CFP, TGP-H-60) was purchased from Toray. Potassium chloride (KCl, 99.5%) and potassium hexacyanoferrate-II trihydrate (K4[Fe(CN)6]·3H2O, 99.5%) were purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). Niobium chloride (NbCl5, 99.8%), hydrogen tetrachloroaurate trihydrate (HAuCl4·3H2O, 99.9%) and potassium hexacyanoferrate-III (K3[Fe(CN)6], 99.5%) were purchased from Aladdin (Shanghai, China). Phosphate buffer solution (PBS, pH 7.4) and 6-mercaptohexanol (MCH) were purchased from Sigma Aldrich (Shanghai, China). Nitrogen (N2, 99.999%) and hydrogen sulfide (H2S, 99.5%) were purchased from Nanjing Special Gas Co. Ltd Cardiac troponin I (cTnI), horseradish peroxidase (HRP), myoglobin (MB), nucleolin (NCL), and thiolated cTnI aptamer (AcTnI): 5′-SH-(C)6-CGTGCAGTACGCCAACCTTTCTCATGCGCGCTGCCCCTCTTA-3′ were purchased from Sangon Biotech Co., Ltd (Shanghai, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!