All reactions were performed in low-retention centrifuge tubes. Unless otherwise stated, all reagents were used as received. [γ-32P]Adenosine triphosphate (ATP) (370 MBq/mL; specific activity = 222 TBq/mmol) was purchased from PerkinElmer (Boston, MA). Recombinant human sphingosine kinase 1 (rhSPHK1) was purchased from R&D Systems (Minneapolis, MN), upon receipt, it was aliquoted into ten parts diluted with buffer A (vida infra) to a final concentration of 1 μg / 10 μL. S1PR1 membranes that were prepared from Chinese hamster ovary (CHO)-K1 cells expressing recombinant human S1PR1 receptors and were used in the study were purchased from Chan Test Corp. (Cleveland, OH). S1PR2-3 membranes that were prepared from Chem-1, an adherent cell line expressing the promiscuous G-protein, Gα15, were purchased from Merck Millipore (Billerica, MA). All the membrane preparations are crude membrane preparations made from proprietary stable recombinant cell lines to ensure high-level of S1PR1-3 surface expression. The kinase aliquots and membranes were stored at −80 °C until use.
γ 32p adenosine triphosphate atp
Manufactured by PerkinElmer
Sourced in United States, France
[γ-32P]Adenosine triphosphate (ATP) is a radioactive form of the energy-carrying molecule ATP, where the gamma phosphate group is labeled with the radioactive isotope phosphorus-32 (32P). This radioactive ATP is commonly used as a tracer in various biological and biochemical applications to study enzyme-catalyzed reactions, DNA synthesis, and other cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using γ 32p adenosine triphosphate atp
1
Sphingosine Kinase 1 Membrane Assay
2
Radioactive Labeling of RNA Probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were radioactively labeled (15 µCi) using either T4‐polynucleotide kinase (10 000 U·mL−1) for 3′‐hydroxyl RNAs or T4 PNK (3′‐phosphatase minus; 10 000 U·mL−1; both from New England Biolabs, Ipswich, MA, USA) for RNA>p and [γ‐32P] adenosine triphosphate (ATP, 6000 Ci·mmol−1, 150 mCi·mL−1; Perkin Elmer, Waltham, MA, USA). One microlitre 1 of RNA probe (100 nm final) was mixed with RNAsin, RNase‐free water, PNK buffer, T4 PNK, and [γ‐32P] ATP in a dedicated Type C laboratory and incubated at 37 °C for 30 min followed by 5 min of heat inactivation at 95 °C. Probes were purified using G‐25 sephadex spin columns (GE Healthcare, Chicago, IL, USA).
3
Oligonucleotide Duplexes with Modified Bases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences of the oligonucleotide duplexes used in the present work are shown in Table 1 . All oligonucleotides containing modified bases and their complementary strands were purchased from Eurogentec (Seraing, Belgium) including the following: 40-mer d(AATTGCTATCTAGCTCCGCX CGCTGGTACCCATCTCATGA) where X is either hypoxanthine (Hx), 8oxoA, 1,N6-ethenoadenine (ϵA), tetrahydrofuran (THF, an abasic site analog), 7,8-dihydro-8-oxoguanine (8oxoG), ϵC, 5,6-dihydrouracil (DHU), alpha-2′-deoxyadenosine and complementary 40-mer d(TCATGAGATGGGTACCAGCGT GCGGAGCTAGATAGCAATT) where T is opposite to the lesion. The oligonucleotides were 5′-end labeled with [γ-32P]-adenosine triphosphate (ATP) (PerkinElmer, France) and then annealed with corresponding complementary strands as described previously (47 (link)). The resulting oligonucleotide duplexes are referred to in the text as X•Y (NYN), where X is a residue in the [32P]-labeled top strand, Y is a residue opposite to X in the complementary non-labeled bottom strand and N is a regular DNA base immediately neighboring the 5′ and 3′ sites of Y.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!