Expression levels of candidate lncRNAs were determined by qRT-PCR using the PrimeScript™ RT Master Mix (perfect Real Time) reagent kit (Takara Bio Inc. Dalian, P.R. China). All reactions were carried out according to the manufacturer's instructions. Briefly, 500 ng total RNA was reverse-transcribed with 5 × PrimeScript RT Master Mix (perfect Real Time). The reverse-transcription reaction was performed according the manufacturer's recommendations (37°C for 15 min, 85°C for 5 s and incubated at 4°C). The expression levels of the lncRNAs were determined with qRT-PCR using the PrimeScript™ RT Master Mix (perfect Real Time) reagent kit (RR036A, Takara Bio Inc. Dalian, P.R. China) and the ABI 7500 real-time PCR system (Applied Biosystems). The conditions for the reactions were those recommended by the manufacturer (95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s). The cycle threshold (Ct) values were calculated with the SDS 2.0.5 software (Applied Biosystems). The average expression levels of the lncRNAs were normalized to the average for GAPDH using the 2−ΔΔCt method. All qRT-PCR experiments were performed at least three times in triplicate. The primers used for qRT-PCR are listed in Supplementary Table S1 .
Primescript rt master mix perfect real time reagent kit
Manufactured by Takara Bio
Sourced in China, Japan
The PrimeScript™ RT Master Mix (Perfect Real Time) Reagent Kit is a tool for reverse transcription and real-time PCR. It contains a reverse transcriptase enzyme, RNase inhibitor, and other necessary reagents for the conversion of RNA to cDNA and subsequent real-time PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr green pcr kit, by Toyobo (3 mentions)
Ab7500 rt pcr instrument, by Thermo Fisher Scientific (3 mentions)
Iq5 instrument, by Bio-Rad (3 mentions)
Abi 7500 real time pcr instrument, by Thermo Fisher Scientific (2 mentions)
Sybr green reagent, by Takara Bio (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Miscript 2 rt kit, by Qiagen (2 mentions)
Spss statistics 22, by IBM (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Iq5 system, by Bio-Rad (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Minibest plant rna extraction kit, by Takara Bio (1 mentions)
Nanodrip 2000, by Thermo Fisher Scientific (1 mentions)
Sds 2, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Iq5 equipment, by Bio-Rad (1 mentions)
Sybr premix ex taq, by Bio-Rad (1 mentions)
12 protocols using primescript rt master mix perfect real time reagent kit
1
Quantification of lncRNA Expression
2
Quantifying miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cultured cells and tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. RNA concentrations were measured using a NanoDrop1000 spectrophotometer (NanoDrop Technologies). RNA integrity was assessed by gel electrophoresis. To detect the expression levels of miR-216a-5p, the miR-216a-5p-specific primers (RiboBio) were used for the reverse transcription of the total RNA. To detect the expression levels of KIAA0101, total RNA (1 µg each sample) was used to synthesize cDNA using the PrimeScript® RT Master Mix Perfect Real-Time Reagent Kit (Takara Bio Inc.). Quantitative reverse transcription PCR (RT-qPCR) for miR-216a-5p and KIAA0101 was performed using a standard protocol based on the SYBR Green PCR kit (Toyobo) on an iQ5 system (Bio-Rad Laboratories, Inc.). The relative expression of miR-216a-5p was normalized against U6, while that of KIAA0101 was normalized to β-actin, both using the 2−ΔΔCq method (20 (link)). When comparing the ΔCq between tumor and normal tissue, 2−ΔCq was used. When normal cells or tissue were used as references, 2−ΔΔCq was compared. The 2−ΔΔCq of normal tissue was 1. Each sample was run in triplicates, and the experiment was repeated at least twice.
3
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions, and RNA quality was confirmed by gel electrophoresis. Total RNA (1 μg each sample) was used to synthesize cDNA utilizing the PrimeScript® RT Master Mix Perfect Real Time Reagent Kit (Takara Bio Inc., Shiga Prefecture, Japan). The cDNA was subjected to RT-qPCR using the SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) Reagent Kit (TaKaRa Bio Inc.) and an AB7500 RT-PCR instrument (Applied Biosystems, Foster City, CA, USA). The PCR reaction protocol consisted of two steps: step 1, initial denaturation for 30 s at 95°C; step 2, denaturation for 5 s at 95°C, annealing and extension for 31 s at 60°C, and fluorescence signal acquisition. The reactions had a total of 40 cycles and ended with a melting curve which consisted of 15 s at 95°C, 1 min at 60°C, 15 s at 95°C, and 15 s at 60°C. PCR primer sequences used were listed in Table 3 . PCR primers were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). The experiments were repeated for 3 times and each sample was run in triplicates. PCR product specificity was confirmed by melting curve analysis. Gene expression levels were normalized to the internal control gene GAPDH and calculated with the 2−ΔΔCT method [24 (link)].
4
Quantitative Real-Time RT-PCR Validation of RNA-Seq Data
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and detection were done as described above. cDNA synthesis was conducted using the PrimeScript™ RT Master Mix (Perfect Real Time) Reagent Kit (Takara, Dalian, China), according to the manufacturer’s instructions. The gene primers used in the quantitative real-time RT-PCR (qRT-PCR) experiment are listed in Table S1 . ACTIN was used as an internal control. The qRT-PCR system was consisted of 10 µL SYBR Premix Ex Taq™ II, 0.8 µL each primer (10 µM), 2 µL diluted cDNA (150 ng), and 6.4 µL nuclease-free water. The qRT-PCR reactions were performed in three biological replicates. The qRT-PCR was carried out using a Bio-Rad IQ5 instrument (Foster City, CA, USA), with the following conditions: 1 cycle of 95 °C for 40 s, 40 cycles of 95 °C for 5 s and 61 °C for 30 s. The relative expression levels were calculated using the 2−ΔΔCt method (Livak & SchmittgenT, 2001 (link)). To verify the RNA-Seq data, the correlation analysis and the Pearson correlation coefficient between log2 (fold change) of RNA-Seq and qRT-PCR was calculated using the IBM SPSS statistics 22 software.
5
Quantitative RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the TRIzol® reagent (AccuRef Scientific) to extract RNA, following the supplier's instructions. RNA concentration was measured in a NanoDrop 2000 device (Thermo Fisher Scientific, Inc.) and cDNA was synthesized with the PrimeScript® RT Master Mix Perfect Real‐Time Reagent kit (Takara Biotechnology Co., Ltd.). Furthermore, qRT‐PCR was performed on an ABI 7500 Real‐Time PCR instrument (Applied Biosystems), using cDNA and SYBR Green Reagent (Takara Biotechnology Co., Ltd.), under the following conditions: 95°C for 5 min, then 40 cycles of 95°C for 15 s, 58°C for 20 s, and 72°C for 10 s. The internal control was either GAPDH (mRNA) or U6 (miRNA). Relative quantification was calculated as 2−ΔCT. ΔCt values were calculated by subtracting the mean Ct value of the control gene from the mean Ct value of the target gene. The following primers were used in this study: ALDH1A3 forward, GATAAGCCCGACGTGGACAA and reverse, ATACAGCCCTCCAGGTCGAT; miR‐4524b‐5p forward, CGCGATAGCAGCATAAGCC and reverse, AGTGCAGGGTCCGAGGTATT; HK2 forward, GTGAATCGGAGAGGTCCCAC and reverse, CAAGCAGATGCGAGGCAATC; PKM2 forward, GCCGAGAGCCAAGAAAAGAC and reverse, GCCCTTTCGGTGGGACTAAA; GAPDH forward, GGAGCGAGATCCCTCCAAAAT and reverse GGCTGTTGTCATACTTCTCATGG; U6 forward, CTCGCTTCGGCAGCACA and reverse AACGCTTCACGAATTTGCGT.
6
Quantitative RT-PCR Analysis of Inflammatory Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), total RNA was extracted from tissues or cells. Reverse transcription was carried out utilizing the PrimeScript® RT Master Mix Perfect Real Time Reagent Kit (Takara Bio Inc., Shiga Prefecture, Japan), and cDNA was used as the template for real-time PCR on an AB7500 RT-PCR instrument (Applied Biosystems, Foster City, CA, USA). The 2−ΔΔCt method was used to calculate the relative expression levels of the genes after normalization with the internal control GAPDH gene [25 (link)]. The sequences of the oligonucleotides used in this study were as follows: TREM1: forward, 5′-AAGTATGCCAGAAGCAGGAAGG-3′, reverse, 5′-GGTAGGGTCATCTTTCAGGGTGT-3′; HMGB1: forward, 5′-ACCCGGATGCTTCTGTCAAC-3′, reverse, 5′-ACAAGAAGGCCGAAGGAGGC-3′; TLR-4: forward, 5′-AGAATGAGGACTGGGTGA-3′, reverse, 5′-AGCGGCTACTCAGAAACT-3′; NF-κB: forward, 5′-GCAAACCTGGGAATACTTCATGTGACTAAG-3′, reverse, 5′-ATAGGCAAGGTCAGAATGCACCAGAAGTCC-3′; TNF-α: forward, 5′-TGACAAGCCTGTAGCCCACG-3′, reverse, 5′-TTGTCTTTGATCCATGCCG-3′; IL-6: forward, 5′-GGCCCTTGCTTTCTCTTCG-3′, reverse, 5′-ATAATAAAGTTTTGATTAGT-3′; IL-1β: forward, 5′-ATAAGCCCACTCTACACCT-3′, reverse, 5′-ATTGGCCCTGAAAGGAGAGAGA-3′; GAPDH: forward, 5′-CCTCTATGCCAACACAGTGC-3′, reverse, 5′-ACATCTGCTGGAAGGTGGAC-3′.
7
Transcriptional Profiling of Ethylene-Responsive Genes during Flower Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At the flowering stage of plants, the female and male flower buds with vertical diameters of 0.5, 1.0, and 2.0 cm, which represent different developmental stages, were collected, respectively, and immediately frozen in liquid nitrogen for RNA extraction. RNA was extracted from the samples using the MiniBEST Plant RNA Extraction Kit (Takara, Dalian, China) and then reverse transcribed into cDNA using the PrimeScript™ RT Master Mix (Perfect Real Time) Reagent Kit (Takara, Dalian, China). Real-time PCR was performed on a Bio-Rad IQ5 instrument (Foster City, CA, United States). Based on the results of ethylene response analysis of CmoAP2/ERF genes, 16 ethylene-induced genes have been selected to explore their expression patterns at different developmental stages of flower. The primers for CmoAP2/ERF genes were designed using the Primer Premier 5.0 software. The sequences of primers are listed in Additional File 1. The reactions were performed as described by the manufacturer. Real-time PCR conditions were as follows: 95 °C for 30 s and 40 cycles of 95 °C for 5 s and 61 °C for 30 s. The RNA expression levels were normalized to that of ACTIN. They were calculated using the 2–ΔΔCt method (Livak and Schmittgen, 2001 (link)). The expression of each gene was determined using three biological and three technical replicates.
8
Quantitative Assessment of Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol® reagent (AccuRef Scientific) was utilized to isolate RNA in accordance with the manufacturer's instructions. The RNA concentration was measured with the Nanodrip 2000 (Thermo Fisher Scientific, Inc.) and cDNA was synthesized using PrimeScript® RT Master Mix Perfect Real-Time Reagent kit (Takara Bio, Inc.). Additionally, qRT-PCR was performed with cDNA and SYBR Green Reagent (Takara Biotechnology Co., Ltd.) on an ABI 7500 Real-Time PCR instrument (Applied Biosystems) as the following conditions: 95°C for 5 min, followed by 40 cycles of 95°C for 15 s, 58°C for 20 s and 72°C for 10 s. GAPDH (mRNA) or U6 (miRNA) served as the internal control. Relative quantification was calculated as 2-ΔCt. ΔCt values = target gene mean Ct value - control gene mean Ct value. The primers involved in this study were shown as following: ALDH1A3 forward, TGAATGGCACGAATCCAAGAG and reverse, CACGTCGGGCTTATCTCCT; miR-320b forward, GCGAAAAAGCTGGGTTGAGA and reverse, AGTGCAGGGTCCGAGGTATT; GAPDH forward, GGAGCGAGATCCCTCCAAAAT and reverse GGCTGTTGTCATACTTCTCATGG; U6 forward, CTCGCTTCGGCAGCACA and reverse AACGCTTCACGAATTTGCGT.
9
Profiling Total RNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA and miRNA samples were obtained using the TRIzol reagent (Thermo Fisher Scientific) and the miRNeasy mini kit (Qiagen, Hilden, Germany), respectively. Reverse transcription was performed with the PrimeScript® RT Master Mix Perfect Real Time Reagent Kit (Takara Bio Inc., Shiga Prefecture, Japan) and miScript II RT kit (Qiagen) for total RNA and miRNA, respectively. Real-time quantitative PCR (RT-qPCR) was conducted using the SYBR Green PCR kit (Toyobo, Osaka, Japan) with a standard AB7500 RT-PCR instrument. RT-qPCR data were analyzed with the 2-ΔΔCT method. The PCR primers used in this study are presented in Supplementary Table 2 .
10
Quantitative Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The first-strand cDNA was obtained using the PrimeScript™ RT Master Mix (Perfect Real Time) Reagent Kit (Takara, Dalian, China). The qRT-PCR was carried out using a Bio-Rad IQ5 instrument (Foster City, CA, United States), as follows: 95°C for 40s and 40cycles of 95°C for 5s and 61°C for 30s. ACTIN was used as an internal control. The primers used for qRT-PCR are listed in Supplementary Material . The expression levels were calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001 (link)). The expression of each gene was determined using three biological and three technical replicates. Furthermore, the correlation analysis and the Pearson correlation coefficient between the log2 (fold change) values obtained in qRT-PCR and RNA-seq were calculated using the IBM SPSS statistics 22 software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!