Lenti xtm concentrator kit

For lentivirus package, two million HEK293T cells were seeded in a 100 mm dish with DMEM and 10% FBS. 24 h after seeding, 10 μg pCMV-dR8.91, 10 μg pCMV-VSVG, and 20 μg target plasmid were co-transfected into 293 T cells using 1 mg/mL PEI. The medium containing plasmid mixture and PEI was exchanged for fresh medium after incubation for 6 h. 48 h after transfection, the medium was collected and then concentrated using the Lenti-XTM concentrator kit (Clontech, 631231). The virus was resuspended using a DMEM medium and stored in aliquots at −80 °C.

The lentiCRISPR-v2 vector was received as a gift from Feng Zhang (Addgene plasmid #52961). Feng Zhang’s laboratory online program¹ was used in designing the sgRNA targets. The two sgRNA target sequences of PRMT5-CRISPR (GAATTGC GTCCCCGAAATAG & CCCGCGTTTCAAGAGGGAGT) used in the study were directed to exon 1 and 2, respectively, of the Prmt5 gene. The other two sgRNAs targeted EGFP gene (GGG CGAGGAGCTGTTCACCG & GAGCTGGACGGCGACGTA AA) and these were used as controls. Both the Prmt5 and EGFP sgRNAs were cloned into the same vector backbone. Cloning was performed according to the Addgene guidelines and as previously described (Shalem et al., 2014 (link); Scaglione et al., 2018 (link)). The lenti-CRISPR viruses were generated by transfecting 293T cells with CRISPR/Cas9 plasmids and packing plasmids, psPAX2 and pMD2.G (from Addgene #12260 and #12259). For transfection of every 10-cm dish of 293T cells with polyethylenimine, 10 μg of lenti-CRISPR/Cas9 plasmids, 6 μg of psPAX2 and 2 μg of pMD2.G plasmids were used. The 293T cells were cultured in 293T medium (DMEM, 1mM sodium pyruvate, 2 mM L-glutamine) supplemented with 10% FBS. Tissue culture media were refreshed 15 h post transfection and media containing viruses were harvested 45 h post transfection. Lenti-X^TM concentrator kit (Clontech) was used in concentrating viruses.