The largest database of trusted experimental protocols
Sourced in United States

The PCS-210-010 is a laboratory equipment product designed for cell culture applications. It serves as a CO2 incubator to provide a controlled environment for cell growth and maintenance. The core function of this product is to maintain temperature, humidity, and CO2 levels within user-defined parameters to support optimal cell culture conditions.

Automatically generated - may contain errors

6 protocols using pcs 210 010

1

Murine and Human Adipocyte Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Murine 3T3-L1 and human PCS-210-010 pre-adipocytes obtained from ATCC (Manassas, VA, USA) were, respectively, cultured in DMEM and FBM containing 10% FBS, 2 mmol/L l-glutamine, and 100 units/mL penicillin/streptomycin in humidified incubator at 37 °C with 5% CO2 and grown to 70−80% confluence before use. Cells between 5 and 17 passages were used in this study.
For adipocyte differentiation, pre-adipocytes were seeded into a 24-well plate at a density of 2 × 104 cells/well. After incubation for 48 h, the differentiation process was counted as day 0, and the cells were treated with differentiation medium containing 0.5 mM IBMX, 1 µM dexamethasone, and 10 µg/mL insulin with or without pinostrobin at non-toxic concentrations. On day 2 of differentiation, the medium was replaced with culture medium containing 10 µg/mL of insulin. On day 4, the cells were further incubated in culture medium with renewal every two days until lipid droplets were obvious upon microscopic examination, approximately on day 8 [35 (link)].
+ Open protocol
+ Expand
2

Generating Adipocytes from Mesenchymal Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
BM cells were flushed out from human fetal femoral bones (Advanced Bioscience Resources), and cultured in DMEM to generate MSCs [46 (link)]. Immunophenotyping of MSCs was analyzed by flow cytometry. To generate mature adipocytes, MSCs were cultured in adipocyte medium (Lonza) for 2 weeks. Adipocytes were also generated from the adipocyte precursor (pre-adipocyte) cell line PCS-210-010 (ATCC), or pre-WAT cells isolated from subcutaneous fat (LONZA), or isolated from the BM aspirates of healthy adults or MM patients, and further purified by 10 min centrifugation at 186 g [47 (link)]. Mature adipocytes were fixed with 4.0% paraformaldehyde, stained with Oil red O for 1 hour, and observed under light microscopy [48 (link)].
+ Open protocol
+ Expand
3

Plasma-Induced Cellular Senescence

Check if the same lab product or an alternative is used in the 5 most similar protocols
For senescence induction by human plasma, 2 × 104 human primary lung fibroblast (IMR-90; CCL-186, ATCC), skeletal muscle myoblasts (CC-2580, Lonza), renal cortical epithelial cells (PCS-400-011, ATCC), subcutaneous preadipocytes (PCS-210-010, ATCC) or mammary epithelial cells (PCS-600-010, ATCC) in 12-well plates were cultured in OptiMEM (Gibco, 31985062) supplemented with 5% plasma from young (20–30 years) or old (70–80 years) human participants for 3 or 6 days. Human plasma samples, without personal identifiers were not linked to or traced back to any personal information, and were purchased from Blood Centres of the Pacific (BSI Facility) as part of an material transfer agreement between Buck Institute for Research on Aging and the Blood Centres of the Pacific. Media were changed every other day until the end of the experiment.
+ Open protocol
+ Expand
4

Dermal fibroblast isolation and culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dermal fibroblasts from the study participant (subject II-3) and his sister (subject II-2), primary human fibroblasts MRC-5 (CCL-171, American Type Culture Collection (ATCC Manassas, VA, USA), and neonatal human dermal fibroblasts (HDFs) (PCS-210-010 and PCS-210-012, ATCC) were plated in separate six-well plates (40,000 cells/well) and cultured using Dulbecco’s modified Eagle’s medium (DMEM) with 20% fetal calf serum (FCS). Mice embryonic fibroblast (MEF) preparations from WT, Adck2+/− and Adck2−/− mice were obtained from fetuses at day 9 postcoitum as described elsewhere [36 (link)].
+ Open protocol
+ Expand
5

Quantitative RT-PCR Validation of Obesity-Associated Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative RT-PCR was conducted to validate the expressions of these hub genes in obesity associated type 2 diabetes mellitus. Total RNAs were extracted from Primary Subcutaneous Pre adipocytes; Normal Human cell line (ATCC® PCS-210-010™) and 3T3-L1 cells (ATCC® CL-173) using TRI Reagent® (Sigma, USA) according to instruction, followed by reverse transcription with Reverse transcription cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA) and cDNA amplification through 7 Flex real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The expressions of hub genes were normalized to against beta actin expression. The data were calculated by the 2−ΔΔCt method [31 (link)]. A primer used in the current investigation was listed in Table 1.

The sequences of primers for quantitative RT-PCR

GenesForward PrimersReverse Primers
CEBPDCGGACTTGGTGCGTCTAAGATGGCATTGGAGCGGTGAGTTTG
TP73CCACCACTTTGAGGTCACTTTCTTCAAGAGCGGGGAGTACG
ESR2AGCACGGCTCCATATACATACCTGGACCACTAAAGGAGAAAGGT
TAB1AACTGCTTCCTGTATGGGGTCAAGGCGTCGTCAATGGACTC
MAP 3K5CTGCATTTTGGGAAACTCGACTAAGGTGGTAAAACAAGGACGG
FN1CGGTGGCTGTCAGTCAAAGAAACCTCGGCTTCCTCCATAA
UBDCCGTTCCGAGGAATGGGATTTGCCATAAGATGAGAGGCTTCTCC
RUNX1CTGCCCATCGCTTTCAAGGTGCCGAGTAGTTTTCATCATTGCC
PIK3R2AAAGGCGGGAACAATAAGCTGCAACGGAGCAGAAGGTGAGTG
TNFCCTCTCTCTAATCAGCCCTCTGGAGGACCTGGGAGTAGATGAG
+ Open protocol
+ Expand
6

Validating Obesity-T2DM Hub Genes via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative RT-PCR was conducted to validate the expressions of these hub genes in obesity with T2DM. Total RNAs were extracted from Primary Subcutaneous Pre-adipocytes; Normal, Human (ATCC® PCS-210-010™) and 3T3-L1 cells (ATCC® CL-173) using TRI Reagent® (Sigma, USA) according to instruction, followed by reverse transcription with Reverse transcription cDNA kit (Thermo Fisher Scienti c, Waltham, MA, USA) and cDNA ampli cation through 7 Flex real-time PCR system (Thermo Fisher Scienti c, Waltham, MA, USA). The expressions of these hub genes were normalized to against beta-actin expression. The data were calculated by the 2 -ΔΔCt method [31] . Primers used in the current investigation were listed in Table 1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!