Pdonr223 egfr

Plasmids encoding shRNAs targeting FAM83A or GFP in pLKO.1 were acquired from Sigma-Aldrich (Sigma Aldrich; sh83A2 TRCN0000168628, sh83A6 TRCN0000168368) [33 (link)]. FLAG-FAM83A expression construct was created using LongAMP TAQ PCR kit (New England Biosystems) (forward primer GGGCCGCCACCATGGACTACAAAGAC, reverse primer GGGCGGCCGCATCGATCCTGGGCCTGCGGA). Reactions included a final Taq extension to create A overhangs for cloning into pCR8 entry vector using pCR8/GW/TOPO TA Cloning Kit with One Shot TOP10 E. coli (Thermo Fisher Scientific). LR clonase (Thermo Fisher Scientific) was used to recombine FLAG-FAM83A into a pLenti CMV Neo Dest vector (Addgene 17392). The EGFR expression vector was created by recombining pDONR223-EGFR (Addgene 23935) with plx304 (Addgene 25890) using LR clonase.
Lentiviral vectors were transfected into HEK293T cells using Lipofectamine 2000 (Thermo Fisher Scientific) together with second generation packaging constructs pCMV-dR8.74 and pMD2G (gifts from D. Trono, University of Geneva, Geneva, Switzerland). Supernatants containing virus were collected at 24 and 48 hours and supplemented with 4 μg/ml polybrene (Santa Cruz) before being frozen in aliquots. Cells were subsequently infected with virus for 16 hours.

Bimolecular fluorescence complementation vectors were generated by gateway cloning with donor vectors containing Axl (pDONR223-Axl, Addgene plasmid 23945) or EGFR (pDONR223-EGFR, Addgene plasmid 23935).^{29 (link)} These were cloned into pDEST-ORF-V1 (Addgene plasmid 73637) and pDEST-ORF-V2 (Addgene plasmid 73638), respectively. An expression vector encoding full length Venus fluorescent protein was also utilised as control. For confocal microscopy, HEK-293T cells expressing an H2B-mCherry nuclear marker were grown on glass coverslips within a six-well plate. These were transfected with 500 ng of each vector (or Venus control) using Polyplus Jetprime and incubated for 16 h. The coverslips were prepared for confocal microscopy by fixation with 1% paraformaldehyde for 5 min at room temperature. For high-content analysis, HEK-293T cells expressing an H2B-mCherry nuclear marker were grown on Greiner CELLSTAR 96-well plates in phenol red free media (Thermo Fisher Scientific). Each well was transfected with 20 ng of each vector (or Venus control) using Polyplus Jetprime and incubated for 16 h, in the presence of absence of gefitinib at the concentrations indicated. Single cell fluorescence intensity was measured using the ArrayScan XTI Live High Content Platform (Thermo Fisher Scientific).