The largest database of trusted experimental protocols

Shclnd

Manufactured by Merck Group

SHCLND is a laboratory instrument designed for the analysis and characterization of samples. It is a versatile and reliable tool that can be used in various scientific and research applications. The core function of SHCLND is to provide accurate and consistent data measurements, enabling researchers and scientists to make informed decisions.

Automatically generated - may contain errors

Lab products found in correlation

2 protocols using shclnd

1

Investigating β-Catenin's Role in GIP/LOX Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
To investigate β-catenin involvement in the GIP/LOX pathway, β-catenin expression was knocked down in MC3T3-E1 cells using a β-catenin shRNA construct (Sigma Aldrich, catalogue# SHCLND). Cells were transfected with the shRNA construct plasmid using FuGene6 as previously described (Khosravi et al., 2014 ). Cells were also transfected with an empty plasmid as well as a non-target shRNA construct against GFP as controls. Cells were grown to confluence for 24 h and then changed to medium containing 4 μg/mL puromycin to select for transfected cells. After two days, cells were transfected with the previously described wild-type LOX promoter luciferase reporter construct, as well as the renilla luciferase reporter construct. Cells were then serum starved overnight and treated with GIP for 4 h. The data were first normalized by calculating the ratio of firefly to renilla luciferase activity then presented as a fold change between GIP treated and control cells. Protein was also isolated by direct lysis of cells in protein sample buffer and analyzed by Western blot with a β-catenin (Santa Cruz catalogue #7963) and LOX antibody (Abcam, catalogue #Ab31238) to examine their respective protein levels.
+ Open protocol
+ Expand
2

Stable Knockdown of NNMT in TM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
We established an anti-NNMT sh-RNA-expressing TM cell line by lentiviral transduction and puromcyin stable selection. Anti NNMT shRNA lentiviral production was as described using mission TRC2-pLKO-Puro series Lentiplasmid (SHCLND, Sigma-Aldrich) scramble shRNA (scr-sh) [10 ] and shRNA targeting NNMT (Sigma-Aldrich TRCN0000294436, TGCAGAAAGCCAGATTCTTAA). WT and TM cell lines expressing either scrambled shRNA (scr-WT, scr-TM) or anti NNMT shRNA (shNNMT-WT, shNNMT-TM) were seeded in 24 well plates until they reached approximately 50% confluency followed by transduction with shRNA virus particles and selection as described [10 ].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!