In a Hirudinea Genomics Consortium, we contributed to create a Hirudo medicinalis draft genome as previously described58 (link). Sequences were assembled from paired short reads using Velvet and PHRAP/CONSED algorithms59 (link),60 and given to GlimmerHMM to get predicted mRNA database61 (link). These predicted mRNA sequences was compared in a Local BLAST program with human TGF-β type I receptor and TGF-β1 amino acid sequences62 (link). The candidate sequences was submitted to Swiss-Prot databases using BLAST in order to specify similarities in TGF-β type I receptors and TGF-β superfamily respectively. From putative partial mRNA sequences, specific primers were designed to get the natural and complete sequences by RACE-PCR from CNS total RNAs (Supplementary Methods S2 and 3 ). PCR products were ligated into the pGEM T-easy vector (Promega, Madison WI, USA) and cloned into JM109 cells according to the manufacturer’s instructions. Finally, products were sequenced using BigDye Terminator v3.0 polymerization kit before detection on Genetic Analyzer (Applied Biosystems, Foster City CA, USA). The assembly of 5′ and 3′ end sequences allowed characterizing the full length mRNA of tgfbr1 and ngdf encoding respectively ALK4/5 (GenBank accession number MH346327) and nGDF (GenBank accession number MH346328) proteins.
Bigdye terminator v3.0 polymerization kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The BigDye Terminator v3.0 Cycle Sequencing Kit is a reagent kit used for DNA sequencing. It contains the necessary components, including the BigDye Terminator v3.0 chemistry, required to perform automated DNA sequencing on compatible instruments.
Automatically generated - may contain errors
2 protocols using bigdye terminator v3.0 polymerization kit
1
Hirudo medicinalis Draft Genome Assembly and Annotation
2
Calreticulin-related Molecule Identification in Leech
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The analysis of Hirudo medicinalis genome allowed in silico prediction of mRNA databases according to intro-exon boundaries. Based on the candidate sequence detected, forward and reverse primers were designed to frame the complete sequence of predicted mRNA. From total RNA extracted from leech nerve cord using TRIzol® reagent and according to the manufacturer’s procedure (Invitrogen, USA), cDNA were synthesized using an oligo(dT) priming. The calreticulin-related molecule was amplified by PCR using the specific forward (5′GGTAGCAATACGTGCAGTTTG3′) and reverse (5′GCAACCAAGAGTAGGCAACC3′) primers and the Platinum®Taq DNA Polymerase according to the manufacturer’s instructions (Invitrogen, USA). Selected PCR products were ligated into pGEM T-easy vector and cloned into JM109 cells according to the manufacturer’s instructions (Promega, USA). Finally, products were sequenced using BigDye Terminator v3.0 polymerization kit before detection on Genetic Analyzer (Applied Biosystems, USA). BLAST programs were used for sequence analysis in databases and comparison with initial predicted mRNA sequence [27 (link),28 (link)]. Phylogenetic analysis was carried out by Geneious® Basic v5.6 software [29 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!