RNA isolation was performed using TRIzol reagent (Invitrogen, USA) and reverse-transcribed into cDNA (Promega) according to the manufacturer's instructions. Quantitative real time PCR was performed using SYBR Green Supermix (Biorad) in Realplex Real-Time Thermal Cycler (Eppendorf). The profile of thermal cycling consisted of initial denaturation at 95°C for 2 min, and 40 cycles at 95°C for 15 s and 60°C for 45 s for primer annealing and extension. Melting curve analysis was used to determine the specific PCR products. All primers used for Real-Time PCR analysis were synthesized by Integrated DNA Technologies, India. 18 s ribosomal RNA was used as an internal control. The sequence of the primers used was (5′ to 3′): Par-4: forward- GCAGATCGAGAAGAGGAAGC , reverse - GCAGATAGGAACTGCCTGGA , 18 s rRNA forward - AAACGGCTACCACATCCAAG , reverse – CCTCCAATGGATCCTCGTTA . The changes in the threshold cycle (CT) values were calculated by the equation: - ΔCT = CT (target) − CT (endogenous control) and fold difference was calculated as 2−Δ (ΔCT).
Realplex real time thermal cycler
Manufactured by Eppendorf
Sourced in Japan
The Realplex Real-Time Thermal Cycler is a laboratory instrument used for the amplification and detection of nucleic acid sequences in real-time. It is designed to perform real-time PCR (Polymerase Chain Reaction) experiments.
Automatically generated - may contain errors
4 protocols using realplex real time thermal cycler
1
Quantitative RT-PCR for Par-4 Expression
2
RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation from cells was performed using Trizol reagent (Invitrogen) and c-DNA was synthesized by Improm II reverse transcriptase system (Promega). The absorbance at 260 and 280 nm was measured using NanoDrop ND-1000 UV-Visible Spectrophotometer. A260/A280 ratio of 1.9 to 2.1 indicated good quality of RNA and c-DNA.
Quantitative real time PCR was performed using SYBR Green Supermix (Biorad) in Realplex Real-Time Thermal Cycler (Eppendorf). The profile of thermal cycling consisted of initial denaturation at 95 °C for 2 min, and 40 cycles at 95 °C for 15 s and 60 °C for 45 s for primer annealing and extension. Melting curve analysis was used to determine the specific PCR products. The changes in the threshold cycle (CT) values were calculated by the equation: - ∆CT = CT (target gene) - CT (endogenous control gene) and fold difference was calculated as . CT values and melting curves were analyzed on Eppendorf Realplex 2.2 software. GAPDH was used as an internal control to normalize gene expression. Fold change for each treated sample was calculated in comparison with constitutive m-RNA levels of the specific gene and graphs were plotted. Sequences of primers used in the study are listed in theSupplemental Table 1 .
Quantitative real time PCR was performed using SYBR Green Supermix (Biorad) in Realplex Real-Time Thermal Cycler (Eppendorf). The profile of thermal cycling consisted of initial denaturation at 95 °C for 2 min, and 40 cycles at 95 °C for 15 s and 60 °C for 45 s for primer annealing and extension. Melting curve analysis was used to determine the specific PCR products. The changes in the threshold cycle (CT) values were calculated by the equation: - ∆CT = CT (target gene) - CT (endogenous control gene) and fold difference was calculated as . CT values and melting curves were analyzed on Eppendorf Realplex 2.2 software. GAPDH was used as an internal control to normalize gene expression. Fold change for each treated sample was calculated in comparison with constitutive m-RNA levels of the specific gene and graphs were plotted. Sequences of primers used in the study are listed in the
3
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation was performed using TRIzol reagent (Invitrogen, Carlsbad, CA) and reverse-transcribed into cDNA (Promega) according to the manufacturer’s instructions. Quantitative real time PCR was performed using SYBR Green Supermix (Biorad) in Realplex Real-Time Thermal Cycler (Eppendorf). The profile of thermal cycling consisted of initial denaturation at 95°C for 2 min, and 40 cycles at 95°C for 15 s and 60°C for 45 s for primer annealing and extension. Melting curve analysis was used to determine the specific PCR products. All primers used for Real-Time PCR analysis were synthesized by Integrated DNA Technologies, India. GAPDH was used as an internal control. The changes in the threshold cycle (CT) values were calculated by the equation ΔCT = CT (target) − CT (endogenous control) and fold difference was calculated as 2− Δ (ΔCT).
Sequence of Primers
YKL 40-L–primer: 5-′AATTCGGCCTTCATTTCCTT -3′, R-primer: 5’-GATAGCCTCCAACACCCAGA-3’.
Fibronectin-1–L-primer: 5′-CTCTTCATGACGCTTGTGGA-3′, R-primer: 5′-ATGATGAGGTGCACGTGTGT-3′,
Olig2-L-primer: 5′-TAGAACTGTGGCCGTTCCTC-3′, R-primer: 5′-TCGGCAGTTTTGGGTTATTC-3′,
DLL3-L-primer: 5′-GGAATCGCCCTGAAGATGTA-3′, R-primer: 5′-ATCGAGGAAGGGTAGGGAA-3′,
GAPDH-L-primer: 5′-ATGGGTGGAATCATATTGGAA-3′, R-primer: 5′-GAAGGTCGGAGTCAACGGATT-3′.
4
Quantitative RT-PCR analysis protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRIzol reagent (Invitrogen, USA) and reverse-transcribed into cDNA (Promega, Madison, WI) according to the manufacturer’s instructions. Quantitative real time PCR was performed using SYBR® Premix Ex Taq™ II (Takara, Japan) in Realplex Real-Time Thermal Cycler (Eppendorf). PCR reactions were performed in duplicates and program consisted of initial activation at 95 °C for 2 min followed by 40 cycles of denaturation at 95 °C for 15 s and primer annealing at 60 °C for 45 s. Melting curve analysis was used to determine the specific PCR products. All primers used for Real-Time PCR analysis were synthesized by Integrated DNA Technologies, India. GAPDH or 18s ribosomal RNA was used as an internal control. List of the primers is included in Table 1 of Supplementary data . The changes in the threshold cycle (CT) values were calculated by the equation: and fold difference was calculated as .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!