Tests were performed as described in the previous section at 30 and 37°C with 5 mM pNP-β-GlcNAc and pNP-β-GalNAc as a substrate. McIlvaine buffers with a pH range from 3.0 to 8.0 were used. Tests for the determination of temperature optimum were performed with 5 mM pNP-β-GlcNAc/pNP-β-GalNAc at different temperatures in a Gradient PCR Thermocycler (Eppendorf, Germany) or thermomixers in McIvaine buffer with the pH as determined to be optimal for the specific hexosaminidase.
Gradient pcr thermocycler
Manufactured by Eppendorf
Sourced in Germany
The Gradient PCR Thermocycler is a laboratory instrument designed for performing polymerase chain reaction (PCR) experiments. It has the capability to create temperature gradients across multiple samples, allowing for optimization of PCR conditions.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using gradient pcr thermocycler
1
Hexosaminidase Substrate Optimization
2
Bacterial 16S rRNA Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
16S rRNA gene was amplified by using primers 16S1F and 16S1R. Primer pairs was given in Table 1 . The reaction mixture was used according to the Wanner 2006 (link) method. PCR was performed with an Eppendorf gradient PCR thermocycler using the following conditions: an initial denaturation at 95 °C for 5 min, 40 cycles consisting of 94 °C for 20 sn, annealing at 59 °C for 30 sn, and extension at 72 °C for 2 min. Products were run on 1.5% agarose gel. Finally, sequencing was carried out via the dideoxy-chain termination method (Intergen, C.O, Ankara, TURKEY).
Primers used in this study
| Primers | Reference | |
|---|---|---|
| 16S rRNA | 16S1F (5’ CATTCACGGAGAGTTTGATCC 3’) 16S1R (5’ AGAAAGGAGGTGATCCAGCC 5’) | Wanner 2006 (link) |
| ERIC-PCR | ERIC 1R (5'-ATGTAAGCTCCTGGGGAT-3') ERIC 2 (5'- AAGTAAGTGACTGGGGGT GAGC-3') | Versalovic et al. 1994 |
| REP-PCR | REP 1R (5'-IIIICGICGICATCIGGC-3') REP 2 (5'-ICGICTTATCIGGCCTAC-3') | Versalovic et al. 1994 |
| BOX-PCR | BOXA1R (5'-CTACGGCAAGGCGACGCTG ACG-3') | Ogutcu et al. 2009 |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!