The largest database of trusted experimental protocols

Lentivirus

Manufactured by Genechem
Sourced in China, Canada

Lentivirus is a type of retrovirus that is commonly used as a vector for gene delivery and expression in various research and clinical applications. It has the ability to integrate its genetic material into the host cell's genome, allowing for stable and long-term gene expression. The core function of lentivirus is to serve as a tool for the delivery and integration of genetic material into target cells.

Automatically generated - may contain errors

335 protocols using lentivirus

1

Lentiviral Gene Transduction in Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CBP/PAG gene sequence was designed by Dr Wang in our laboratory. Lentiviruses containing CBP and enhanced green fluorescent protein (EGFP) genes, and lentivirus containing EGFP alone genes were constructed by Shanghai GeneChem Co., Ltd. (Shanghai, China). Briefly, Jurkat cells were plated at 5,000 cells/well in 96-well plates 24 h prior to transfection. The Lentiviruses [108 TU/ml; multiplicity of infection (MOI) is 50] and polybrene (Shanghai GeneChem Co., Ltd., Shanghai, China; 0.5 mg/ml; 10 µl/well) were added to the cell suspension, which was then cultured in at 37°C in a 5% CO2 incubator. At 8 h post-transfection, target cells were centrifuged at 200 × g for 10 min at 37°C. Subsequently, cells were cultured in RPMI-1640 medium containing 10% FBS and 1% penicillin and streptomycin at 37°C with 5% CO2. At 48 h post-infection, cells were visualized using a fluorescent confocal microscope (FV-1000; Olympus Corporation, Tokyo, Japan) and single-cell sorted using a Guava EasyCyte mini flow cytometer (EMD Millipore). EGFP fluorescence (excitation at 488 nm) was detected using a 530/30-nm bandpass filter. Single cell sorting allowed the visualization of green fluorescence in microcultures.
+ Open protocol
+ Expand
2

Stable Overexpression and Knockdown of GC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the construction of stable overexpressing and stable knockdown of GC cell lines, we purchased lentivirus from Genechem (Shanghai, China) and infected MGC803 and AGS with lentivirus. Subsequently, 10% FBS containing 2 μg/mL puromycin (Beyotime, Shanghai, China) was used to screen stably overexpressing and stably knockdown GC cell lines.
circRAB31 siRNA, all miRNA mimic, inhibitor, and their corresponding normal control were designed and synthesized by RiboBio (RiboBio, Guangzhou, China). The detailed nucleotide sequences are listed in Table S1. WT and MUT dual-luciferase reporter plasmid of circRAB31 and 3′UTR of PTEN were bought from Gene Create (Gene Create, Wuhan, China). For transfection, Plasmid and oligonucleotide were co-transfected into the GC cell lines with Lipofectamine 2000 (Invitrogen, Carlsbad, CA).
+ Open protocol
+ Expand
3

Lentiviral Transduction of miR-142a-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols
In this experiment, miR-142a-3p overexpression, knockdown and control groups were constructed using the plasmid hU6-MCS-Ubiquitin-EGFP-IRES-puromycin (Genechem, Shanghai, China). Lentivirus (Genechem) was used to package the plasmid, and finally used to transfect cells. The method is as follows: the vector and the target fragment were each digested with the same restriction enzymes (Beyotime, Shanghai, China) and, after agarose electrophoresis, the gel was cut to recover the product. The recovered vector and the target fragment were ligated overnight at 16°C; the ligation product was used to transform Escherichia coli. The Plasmid Midi Preparation Kit (Beyotime) was used to extract the plasmids.
The cells were planted in a 24-well plate at a density of 30–50%, and GM, lentiviral infection enhancing reagent (Genechem) and 1.5 × 107 TU/mL Lentivirus were added sequentially. The total volume was 500 μL. After 72 hours of culture, the culture medium was replaced with GM and the transfection efficiency was observed under a fluorescence microscope (MZ75, Leica, Bensheim, Germany). Cells expressing green fluorescent protein were deemed to be successfully transfected. The cell transfection rate was calculated as the number of green fluorescent cells/total cells.
+ Open protocol
+ Expand
4

Lentiviral Transduction of CRC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human CRC cell lines SW480, SW620, HCT116, HT29, and LoVo used in this study were cultured in RPMI 1640 medium (RPMI 1640; HyClone) supplemented with 10% fetal bovine serum (FBS, Gibco). All cell lines were incubated at 37°C in a humidified atmosphere containing 5% CO2. SW480 cells were infected with a lentivirus expressing EMCN or a corresponding control lentivirus (Shanghai Genechem Co.) at a multiplicity of infection (MOI) of 10. LoVo cells were infected with an EMCN‐knockdown lentivirus or a corresponding control lentivirus (Shanghai Genechem Co.) at an MOI of 50.
+ Open protocol
+ Expand
5

STAT1 Knockout in HCC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HCC cell lines SMMC7721 and HepG2 were obtained from the Zhong Qiao Xin Zhou Biotechnology (China). SMMC7721 cells were cultured in RPMI 1640 (Corning, Inc., Corning, NY, USA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. HepG2 cells were cultured in Dulbecco’s modified Eagle’s medium (Corning, Inc., Corning, NY, USA) supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were cultured at 37°C in 5% CO2. Lentivirus (GeneChem, Shanghai, China) was used for STAT1 knockout. The most appropriate multiplicity of infection was 10, as recommended by the protocol. Complete medium, HiTransG A (GeneChem, Shanghai, China), and Lentivirus were mixed and then added to inoculated cells on 6-well plates for transfection. After transfection for 16 h, the medium was replaced with complete culture medium containing 2.5 μg/mL puromycin, and the cells were incubated for 48 h. The concentration of puromycin was then successively reduced to complete the screening. The transfection efficiency was confirmed using western blot after 72 h.
+ Open protocol
+ Expand
6

Lentiviral Knockdown of Sdc4 in EPCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus for stable shRNA integration into the host genome was purchased from Shanghai Genechem Co, Ltd. Target sequence for human Sdc4 was 5_-TGATCCTACTGCTCATGTA 23_. To achieve stable knockdown, late EPCs seeded on 6-well plates were transduced at 70%-80% confluence with Lentivirus carrying a synd4 shRNA (Lv si-synd4) sequence or null (Lv null). Lentivirus also carried the puromycin-resistance and green fluorescent protein genes. Cells were infected for 6 hours in medium without serum, following which the medium was replaced with complete medium. Puromycin (1 lg/ml) was added to cells 48 hours after infection and selection occurred over 3 days. The cells were identified by CD45 2 /CD34 1 /KDR 1 . The inhibition efficiency was verified by Western blot analysis (Supporting Information Fig. 1). Cells were then used in the chemotaxis assay, as previously reported [23] . Detailed descriptions are provided in the online-only Data Supplement.
+ Open protocol
+ Expand
7

Stable Transfection of MSCs with miR-223-5p Inhibitor

Check if the same lab product or an alternative is used in the 5 most similar protocols
For cell transfection, MSCs were stably transfected with miR-223-5p inhibitory sequence (i223) containing lentivirus (Genechem, Shanghai, China) or lentivirus containing scrambled control sequences. MSCM was used to prepare a cell suspension with a density of 3-5×10 4 cells/mL, which was inoculated into a 6-well plate and cultured at 37℃ for 16-24 h until cells reached a con uence of 20%-30%. The infection reagent and lentivirus were added to MSCs according to the manufacturer's instructions. After 72 h of infection, the medium was changed to MSCM without exosomes containing 10 μmol/L TSA.
+ Open protocol
+ Expand
8

Modulating AHR, ROCK1, and PTGS2 in ESCC

Check if the same lab product or an alternative is used in the 5 most similar protocols
ESCC cells were transfected with lentivirus (Genechem, China) or siRNAs (OriGene, USA). For AHR transfection, shRNA 1 sequence was used as GCATAGAGACCGACTTAAT and shRNA 2 as AACAAGATGAGTCTATTTA. For ROCK1, siRNA 1 sequences were 5′-CGGUUAGAACAAGAGGUAAAUGAAC-3′ and siRNA 2 were 5′-GGAAAUAUCAAACGAUAUGGCUGGA-3′. For PTGS2 (COX2), siRNA 1 squences were 5’GGCUAAUACUGAUAGGAGAGACUAT-3′ and siRNA 2 were 5′-GCAGCUUCCUGAUUCAAAUGAGATT-3′. Meanwhile, overexpression of AHR (OE-AHR) with lentivirus (Genechem, China) in TE1 and KYSE150 cell lines was also conducted with sequence as GAGGATCCCCGGGTACCGGTCGCCACCATGAACAGCAGCAGCGCCAACATC.
+ Open protocol
+ Expand
9

Modulation of PI3K-AKT Pathway in Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
MФs were treated with chemical inhibitors LY294002 (10 μM) or MK2206 (10 μM) or activators 1,3-dicaffeoylquinic acid (1,3-diCQA) (10 μM) or YS-49 (10 μM) (MedChemExpress, Monmouth Junction, NJ) of the PI3K-AKT pathway for 24 hours.47 (link) The control group was treated with DMSO. Lentivirus expressing a shRNA targeting Akt1 and Lentivirus selectively expressing Akt1, both of which were synthesized by Shanghai GeneChem Co., Ltd. (Shanghai, China), were added to THP1-derived MФs to knockdown or overexpress Akt1, respectively. For the control, a lentiviral vector that expresses GFP alone was used. MФs were cultured for 72 h following infection and selected in puromycin (2 μg/mL). Effective knockdown and overexpression were evaluated by fluorescence microscopy and western blot analysis.
+ Open protocol
+ Expand
10

Stable Transfection of MSCs with miR-223-5p Inhibitor

Check if the same lab product or an alternative is used in the 5 most similar protocols
For cell transfection, MSCs were stably transfected with miR-223-5p inhibitory sequence (i223) containing lentivirus (Genechem, Shanghai, China) or lentivirus containing scrambled control sequences. MSCM was used to prepare a cell suspension with a density of 3-5×10 4 cells/mL, which was inoculated into a 6-well plate and cultured at 37℃ for 16-24 h until cells reached a con uence of 20%-30%. The infection reagent and lentivirus were added to MSCs according to the manufacturer's instructions. After 72 h of infection, the medium was changed to MSCM without exosomes containing 10 μmol/L TSA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!