Stemdiff neural progenitor medium

Conventional neural differentiation of the iPSCs was performed by replacing the mTeSR™1 culture medium with STEMdiff™ neural induction medium (NIM; STEMCELL Technologies) supplemented with a 10 μM Rhoassociated Coil Kinase inhibitor (ROCK inhibitor, Y-27632; STEMCELL Technologies). The cells were maintained for 3–4 passages with medium changes every 2 days. For longer-term maintenance of differentiated cells, the neural induction medium was replaced with STEMdiff™ neural progenitor medium (NPM; STEMCELL Technologies).

LentiCRISPRv2 backbone plasmid was purchased from Addgene (#52961). The sgRNA targeted to pre-miR-27a was designed (gtggctaagttccgcccccc) and cloned into LentiCRISPRv2 using Esp3I (Thermofisher Scientific, Waltham, CA, USA) digestion as described^{53 (link)} and this plasmid was referred to as lenti-CRISPR-miR-27a thereafter. For overexpression experiments, pri-miR-27a sequences containing T (wild type) and C (mutant) at rs895819 were cloned into pcDNA 3.1(+) under the control of CMV promoter. U-251MG cell line was purchased from the BeNa Culture Collection and cultured in DMEM (Thermofisher Scientific) Suppemented with 10% FBS (Thermofisher Scientific), 100 IU/mL of penicillin, and 100 mg/mL of streptomycin at 37 °C in a fully humidified atmosphere containing 5% CO2. U-251MG cells were verified prior to use by Saily Bio (Shanghai, China). Neural progenitor cells (NPCs) were purchased from ATCC (ACS-5003) and cultured in STEMdiff neural progenitor medium (STEMCELL Technologies, BC, Canada) at 37 °C in a fully humidified atmosphere containing 5% CO₂. The cell lines were tested for no mycoplasma contamination and authenticated at VivaCell Shanghai using short tandem repeat analysis.

Two hiPSC lines (U2F and ACS-1011) used in this study were derived from healthy individuals. The U2F hiPSCs was obtained from the Cellapy Technology (Beijing, China), and the ACS-1011 was obtained from the American type culture collection (ATCC). Pluripotency and karyotype of U2F hiPSCs were confirmed by immunofluorescence and karyotype analysis as shown in our previous studies^{46 (link),47 (link)}. The hiPSCs were cultured in Matrigel (Corning, 354277)-coated plate and supplemented with the mTeSR Plus medium (STEMCELL Technologies, 05825) and 1% penicillin/streptomycin (Gibco, 10378016).
As described in our previous study^{46 (link)}, hNPCs were induced from U2F hiPSCs using the STEMdiff^™ Neural Induction Medium (STEMCELL Technologies, 05835). The hNPCs were cultured in Matrigel-coated plate and maintained in the STEMdiff^™ Neural Progenitor Medium (STEMCELL Technologies, 05833).
The SH-SY5Y neuroblastoma cells were cultured in high-glucose DMEM (Gibco, C11995500BT) supplemented with 10% fetal bovine serum (Gibco, A3161001C) and 1% penicillin/streptomycin.

Primed PSCs were differentiated into expandable NPCs by using the STEMdiff SMADi Neural Induction Kit (Stem Cell Technologies) as previously described [34 (link)–36 (link)]. In brief, primed PSCs were maintained on a Matrigel (Corning)-coated plate in mTeSR1 media (Stem Cell Technologies) prior to the NPC induction. The cells were harvested using Accutase (EMD Millipore) and transferred at 3 x 10⁶ cells to a well of an AgrreWell800 plate (Stem Cell Technologies) in STEMdiff Neural Induction Medium + SMADi (Stem Cell Technologies) supplemented with 10 μM Y-27632. Five days later, uniformly sized aggregates were collected using a 37 μm Reversible Strainer (Stem Cell Technologies) and plated onto a Matrigel-coated 6-well plate in STEMdiff Neural Induction Medium + SMADi. Seven days later, neural rosette structures were selectively removed by using STEMdiff Neural Rosette Selection Reagent (Stem Cell Technologies) and plated onto a new Matrigel-coated 6-well plate in STEMdiff Neural Induction Medium + SMADi. After that, the cells were passaged every 2–3 days until day 30 post-differentiation. The established NPCs were maintained on a Matrigel-coated plate in STEMdiff Neural Progenitor Medium (Stem Cell Technologies) and passaged every 3–4 days.

HEK293 (gifted and DSMZ, CRL-1573, referred to as 293/293WT) cells were cultured in DMEM/F12 with GlutaMAX (Gibco, 10565018) with 10% filtered FBS (Gibco, 10270106) under 5% CO₂. Cells were cultured at 37°C unless otherwise stated, then 37°C served as a control. In addition to HEK293, we used the following cell types HEK293T (gifted, CRL-3216), HCT-116 (gifted, CCL-247), HeLa (gifted, CCL-2), Jurkat (gifted, TIB-152), K562 (gifted, CCL-243), SK-N-SH (gifted, HTB-11). Cells were sub-cultured when they had reached 70–90% confluence and media was changed every other day. Killing curves were used for all cell lines to determine lowest selection concentration for all selection agents. We used culture recommendations from ATCC when possible. We also used human iPS cells (ATCC, ACS-1019) that were used to generate NPCs by neural induction of iPSCs using dual SMAD inhibition and embryoid body generation (StemCell Technologies; 08581, 05832, 05838)^{77 (link)}, prior to experiments described here the NPCs were cultured in STEMdiff Neural Progenitor Medium (StemCell Technologies, 05833) on Matrigel (Corning, 354234). As well as murine primary NPCs (see section mNPC isolation for further information).