Chondrocytes (C57BL/6 mice) were cultured in 2.5% pO2 for 48 h. The ChIP assay was performed using the SimpleChIP® Plus Sonication Chromatin IP Kit (Cell Signaling Technology, MA, USA) according to the manufacturers’ protocols. Briefly, after washing with PBS, cells were incubated with 1% formaldehyde for 10 min at room temperature. The cells were incubated with glycine for 5 min at room temperature and washed twice with PBS. After incubation with Sonication Cell Lysis Buffer (1% SDS, 10 mM EDTA, 50 mM Tris, pH 8.1), the lysates were sonicated to make 300–500 bp chromatin fragments. Chromatin was fragmented by sonication and then incubated with specific antibody (1 μg per IP sample) overnight at 4 °C. The IP samples were then incubated with ChIP-Grade Protein G Magnetic Beads and washed with low- and high-salt buffers. Elute chromatin from the antibody/Protein G Magnetic Beads for 30 min at 65 °C with Elution Buffer and then reverse cross-links. DNA was purified using spin columns and used as a template for PCR and RT-qPCR assays.
Simplechip plus sonication chromatin ip kit
Manufactured by Cell Signaling Technology
Sourced in United States
The SimpleChIP Plus Sonication Chromatin IP Kit is a laboratory equipment product. It is designed to facilitate chromatin immunoprecipitation (ChIP) experiments. The kit provides reagents and protocols for the efficient sonication of chromatin samples and the subsequent immunoprecipitation of protein-DNA complexes.
Automatically generated - may contain errors
Lab products found in correlation
Microson ultrasonic cell disruptor xl, by Bioventus (8 mentions)
Anti h4k20me1, by Abcam (4 mentions)
Microson xl ultrasonic cell disruptor xl, by Bioventus (4 mentions)
S220 focused ultrasonicator, by Covaris (2 mentions)
Lysis buffer, by Cell Signaling Technology (2 mentions)
Glycine, by Solarbio (2 mentions)
Anti h4k20me1 antibody, by Abcam (2 mentions)
H4k20me1, by Abcam (2 mentions)
Dynabeads protein g, by Thermo Fisher Scientific (2 mentions)
Anti h3k27ac, by Cell Signaling Technology (2 mentions)
Chip grade protein g magnetic beads, by Cell Signaling Technology (2 mentions)
Bioruptor, by Cosmo Bio (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Anti klf4, by Abcam (1 mentions)
Ab4729, by Abcam (1 mentions)
Normal rabbit immunoglobulin g, by Cell Signaling Technology (1 mentions)
Trizol agent, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Sybr premix ex taq tli rnaseh plus, by Takara Bio (1 mentions)
Ab34718, by Abcam (1 mentions)
87 protocols using simplechip plus sonication chromatin ip kit
1
Chromatin Immunoprecipitation Assay in Hypoxic Chondrocytes
2
ChIP-qPCR Analysis of AhR Binding in HER2-Positive Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HER2-5 and HER2-5/AHRKO cells were seeded into 100 mm culture dishes and incubated for 48 h. Subsequently, a ChIP assay was performed using the SimpleChIP® Plus Sonication Chromatin IP kit (Cell Signaling Technology) according to the manufacturer’s protocol. Chromatin was digested using the Bioruptor (Cosmo Bio, Tokyo, Japan) and immunoprecipitated using anti-AHR antibodies (D5S6H; Cell Signaling Technology) or IgG (Cell Signaling Technology) as a control overnight at 4 °C. The precipitated DNA fragments were quantified by qPCR using the GoTaq® qPCR Master Mix (Promega) and primers specific to ΔNp63 enhancer R1 (chr3:189573177+189573353; forward, 5′-CTGATGCAGTCCCATTTCCT-3′ and reverse, 5′-AGTGCTCCAGGCAAAAAGAA-3′), ΔNp63 enhancer R2 (chr3:189573177+189573353; forward, 5′-AAAAACATGGCTGCACTT′CC-3′ and reverse, 5′-GGTTCTCAGAGCCATGTGGT-3′), ΔNp63 enhancer R3 (chr3:189722302+189722464; forward, 5′-TTTGGAATTGGCAGGTAAGG-3′ and reverse, 5′-GAGCTCTAAGGCCCTCTGGT-3′), ΔNp63 enhancer R4 (chr3:189841878+189842185; forward, 5′-ACTGCGTGAGGCTTTGTCTTGGACC-3′ and reverse, 5′-GCAGTAGCAGCATGTCTGTCTCAGC-3′), and the CYP1B1 enhancer (chr2:38076942-38077091; forward, 5′-TGTCAGGTGCCGTGAGAA-3′ and reverse, 5′-CGAACTTTATCGGGTTGAA-3′).
3
ChIP Assay for COMMD4 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using the SimpleChIP® Plus Sonication Chromatin IP Kit (Cell Signalling) in DRGFP cells51 (link), according the manufacturer’s procedure and additionally using the protocol previously described52 (link). Briefly, COMMD4-FLAG was overexpressed in DRGFP cells and 16 h later, cells were transfected with I-Sce1. In total, 12–24 h post-transfection with I-Sce1, ~2–5 × 107 DR-GFP cells with and without I-Sce1 induction were fixed with formaldehyde to cross-link the DNA and proteins and chromatin was sheared by sonication. FLAG antibody was used to immunoprecipitate COMMD4, the protein-DNA cross-links were reversed and DNA was purified and analysed by qPCR using the primers previously described20 (link),34 (link).
4
Chromatin Shearing and Crosslinking Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells were grown, transfected, and nuclei were harvested as above. Aliquots of 5 million nuclei each were prepared from wildtype cells, cells transfected with the active dCas9-DNMT3A + gRNA construct (active group), and cells that were transfected with the mutant dCas9-DNMT3A construct (inactive group). Pelleted nuclei were resuspended with 1mL filtered 1X PBS and 200X Protease Inhibitor Cocktail, and cross-linked with 1% formaldehyde for 7 minutes, at room temperature, with gentle rotation. After the fixation reaction was stopped with 10X glycine, nuclei were pelleted and washed twice with 1XPBS+PIC and resuspended in Sonication Nuclear Lysis Buffer, and chromatin was prepared as per the manufacturer’s protocol (SimpleChIP Plus Sonication Chromatin IP Kit, Cell Signalling Technologies, Massachusetts). Chromatin was sheared on a S220 focused ultrasonicator (Covaris, Massachusetts) under the following conditions: 150 peak power, 200 cycles/burst, duty factor 10, for 15 minutes.
5
ChIP Assay of GR Binding to Xist Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays was performed using a SimpleChIP Plus Sonication Chromatin IP Kit (#56383) and a monoclonal antibody against GR (#3660S) according to the manufacturer’s instructions (Cell Signaling Technology, Inc.). Briefly, MSCs isolated from 6-month-old male C57BL/6 mice were cultured in 150mm plates under standard cell culture condition in DMEM supplemented with 10% FBS and antibiotics. When cells reach ~90% confluency they were treated with 100 nM Dex for 30 min. to induce GR nuclear translocation. The cells were washed, cross-linked and chromatin fragmented according to the manufacturer’s instructions. The fragmented chromatin (from 2 plates) were precipitated overnight at 4°C with anti-GR or normal rabbit IgG (control). After reversal cross-link and DNA purification, the GR-bound Xist promoter fragments were PCR amplified with following primer pairs (numbers in brackets indicate amplicon size). GRE 1: (F) TGAAGAGCCCTTCCTTG, (R) GTAAAGGTTACTTTGTCTAACT (132bp); GRE 2/3: (F) TGTCCTTTATTATTCATGGGA, (R) GTGTCTGATCTCTTTCATGT (130bp); GRE 4: (F) GATAATTTAGGAACCAAGGA, (R) CTTCTACTTGGACAAACC (134bp).
6
ChIP-qPCR Analysis of KLF4 and H4K20me1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays were conducted with Simple ChIP Plus Sonication Chromatin IP Kit (Cell Signaling Technology, MA) according to the manufacturer’s instructions. Briefly, cells (1 × 107) were fixed with 1% formaldehyde for 10 min at room temperature to cross-link DNA and proteins. Glycine was then added to stop the cross-linking. Chromatin was sheared using Microson Ultrasonic Cell Disruptor XL (Misonix) with 16 cycles of sonication (15 s each, 2-min rest; amplitude = 10, power = 15 W). Ten-microliter sonication solution was taken out from each sample as the input control, and the remaining was incubated with anti-KLF4 (Abcam, USA) or anti-H4K20me1 (Abcam, USA), or histone H3-positive control, or IgG negative control at 4 °C overnight. Immunoprecipitates were bound to protein G magnetic beads, and the DNA–protein cross-link was reversed at 65 °C for 2 h. DNA was purified and enrichment of DNA sequences was detected using qPCR. SIRT4 oligonucleotide sequences for PCR primers were forward 5′-GAAGAGATGGGATCTCACTTTGTC-3′ and reverse 5′-GTAGACAACCAGAACTGCCGCTCT-3′.
7
Histone H3K27ac ChIP-qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer's instructions, chromatin immunoprecipitation (ChIP) assays were conducted using a Simple ChIP Plus Sonication Chromatin IP Kit (Cell Signaling Technology). HPAEpiC cells were fixed with 1% formaldehyde at 37°C for 10 min, incubated in a lysis buffer and sonicated to shear genomic DNA. Soluble chromatin was incubated with an anti‐H3K27ac antibody (ab4729, Abcam) and normal rabbit immunoglobulin G (2729, Cell Signaling Technology) at 4°C for 12 h. The immunoprecipitate was bound to protein G magnetic beads, and DNA–protein crosslinking was terminated by incubation at 65°C for 2 h. Finally, the immunoprecipitated DNA sequences were quantified by PCR (Table S4 ).
8
Chromatin Immunoprecipitation of Flag-Tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA chromatin was isolated from CFs using a SimpleChIP Plus Sonication Chromatin IP Kit (Cell Signaling Technology), as described previously 23 (link). After the transfection of adenoviruses 48 hours, a Flag antibody was used to immunoprecipitate the protein-DNA complexes, and mouse IgG was used as the control. The primers listed in the supplementary methods were used to detect ChIP DNA using PCR. Refer to the supplementary methods for details.
9
RNA Extraction, cDNA Synthesis, and ChIP Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol agent (Invitrogen, #15596018) and subjected to cDNA synthesis using PrimeScript RT Master Mix (Takara, #RR036). qPCR was performed using SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara, #RR420) following the manufacturer's instructions. All data was normalized to the housekeeping gene β-actin, and quantitative measures were obtained using the comparative CT method. Primers used for qPCR are listed in Supplementary Table S8 . ChIP assays were performed using a SimpleChIP Plus Sonication Chromatin IP Kit (Cell Signaling Technology, #56383) according to the manufacturer's instructions. All data was displayed as corresponding fold change and anti-rabbit IgG was regarded as a negative control. The primer pairs used for ChIP analysis are listed in Supplementary Table S8 .
10
ChIP-seq Analysis of Epigenetic Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using the SimpleChIP Plus Sonication Chromatin IP Kit according to the manufacturer’s instructions (56383, Cell Signaling Technology) with modification [51 (link)]. Briefly, the HTR-8/SVneo cells were crosslinked with 1% formaldehyde (F8775, Sigma) for 10 min at room temperature. After sonication, the sheared chromatins were incubated with specific antibodies (anti-H3K4me3, ab6002, Abcam or anti-KDM5C, ab34718, Abcam); and then precipitated with Protein A or Protein G. The immunoprecipitated complex was washed, and the input and ChIPed DNA were purified using QIAquick PCR Purification Kit (Qiagen). Primer sequences used for ChIP-qPCR are listed in Supplementary Table 4 .
Using bwa version 0.7.10 [52 (link)], ChIP-Seq data was aligned to the human genome (hg19) reference genome. By converting raw bam files to bigwig files using IGV tools [53 (link)], we could perform visualization of the read count data. For identifying peaks, MACS2 peak caller version 2.1.1 was used with an initial threshold q-value of 0.01 as the cutoff and the sonicated input as a control.
Using bwa version 0.7.10 [52 (link)], ChIP-Seq data was aligned to the human genome (hg19) reference genome. By converting raw bam files to bigwig files using IGV tools [53 (link)], we could perform visualization of the read count data. For identifying peaks, MACS2 peak caller version 2.1.1 was used with an initial threshold q-value of 0.01 as the cutoff and the sonicated input as a control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!