Ab150678

Oil Red O staining was performed using a kit from Abcam (ab150678) to analyze lipid deposits in the young and aged human and mouse SKM frozen sections, following the protocol recommended by the manufacturer. Collagens in mouse skeletal muscle were visualized with the Picrosirius Red Stain Kit (Abcam, ab150681) following the manufacturer's protocol.

Frozen tissue sections were mounted on slides and allowed to dry. Mounted sections were dehydrated in 100% propylene glycol for 5 min and then stained with ORO for 10 min (Abcam, catalog #ab150678). The sections were then differentiated in 85% propylene glycol for 3 min and rinsed with distilled water 3 times. Coverslips were applied to all slides using an aqueous mounting medium (Vector Laboratories, catalog #H-1400). Stained sections were imaged with a Keyence BZ-X700 digital microscope.

For Oil Red O staining, the manufacturer’s guidelines (Abcam, ab150678) were followed and slides mounted in aqueous media (Sigma-Aldrich, GG1).
AAV virus production and i.p. injection into mice. The AAV-DJ/8 Helper Free Expression System (Cell Biolabs, VPK-410-DJ-8) was used to generate the virus. The N-terminal FLAG-tagged Human DYRK1B ORF (Sino Biologicals, HG12248-NF) and DYRK1B^K140R,Y273F were cloned into the AAV expression vector. The plasmids encoding adenoviral gene products and Rep-Cap proteins and AAV expression vectors encoding DYRK1B-WT or DYRK1B^K140R,Y273F or with no insert (AAV control) were cotransfected into 293AAV cells (Cell Biolabs, AAV-100). The virus was released from the cell lysates according to the manufacturer’s instructions (AAV-DJ/8 Helper Free Expression System), and nucleic acids were digested by benzonase (50 U/mL) at 37°C for 30 minutes and purified by iodixanol density-gradient ultracentrifugation. The titers of AAV were obtained by quantitative PCR (qPCR; Clontech, 632252) using the following primers: forward, AGTTGGCCACTCCCTCTCTGC; reverse, TGCAGGCAGCTGCGCGCT. One hundred vector genomes were injected i.p. per mouse twice at a duration of 1 month, and mice were sacrificed 3 months later. AAV8-GFP (GFP in the expression vector) was injected to check for in vivo transduction efficiency.

Primary human dermal fibroblasts (HDFs) were cultured as previously described [18 (link), 19 (link)]. Fifteen foreskin samples were collected from healthy males. None of the donors had any medical conditions or were under medication. Briefly, HDFs were isolated from the tissue specimens by enzymatic digestion using collagenase (Roche). Cells were cultured in Dulbecco's Modified Eagle's Media-high glucose (DMEM; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in a 5% CO₂ humidified incubator. To induce steatosis, we used human dermal fibroblasts (HDFs) using sodium palmitate (10 mmol/L, Sigma-Aldrich) and sodium oleate (10 mmol/L, Sigma-Aldrich) for 24 h. For Oil Red staining, Lipid Stain were purchased from Abcam (ab150678) and used the following manufacturer's instructions.

Cells were fixed in Propylene Glycol and stained with Oil red O (Abcam, ab150678) according to the manufacturer's instructions. For immunostaining, hcSMCs were fixed in 4% paraformaldehyde in PBS and incubated with primary antibodies against human CD68 (Abcam ab955; dilution, 1:100) and α-Smooth Muscle actin (Abcam ab32575; dilution, 1:500) at 4 °C overnight. After washing in PBS, cells were incubated for 1 h at room temperature with Anti-Rabbit IgG H&L (Alexa Fluor® 555) (Abcam ab150086) and Anti-Mouse IgG H&L (Alexa Fluor® 488) (Abcam ab150117) followed by incubation with Slowfade Diamond Antifade Mountant with DAPI (Thermo Fisher Scientific S36964).