Total RNA was isolated from CRC surgical specimens and reverse transcribed as previously described [53 (link)]. Real-time quantitative PCR was performed using an IQ5 Multicolor Detection System (Bio-Rad) with a Hairpin-it miRNAs qPCR Quantification Kit (GenePharma, Shanghai, China) according to the manufacturer's instructions. The primers used for miRNA detection by qRT-PCR were designed based on sequences provided by the Sanger Center miRNA Registry. The U6 snRNA was used as an endogenous control. The following program was used for the RT reaction: 16°C for 30 min, 42°C for 30 min and 85°C for 10 min. The following program was used for qPCR: 95°C for 3 min, 40 cycles of 95°C for 12 s and then 62°C for 35 s. The primers used were PD-L1 (forward, 5′-CATCTTATTATGCCTTGGTGTAGCA-3′; reverse, 5′- GGATTACGTCTCCTCCAAATGTG-3′) and β-actin (forward, 5′-GCATCCCCCAAAGTTCACAA-3′; reverse, 5′-AGGACTGGGCCATTCTCCTT-3′). The following program was used for PCR: 94°C for 5 min, 35 cycles of 94°C for 30 s, 58°C for 40 s and 72°C for 30 s, and then 72°C for 10 min. Relative expression changes were calculated using the 2−ΔΔCT (where CT is threshold cycle) method. Three parallel repeats were performed for each sample in each experiment and results were expressed as the mean of three independent experiments.
Iq5 multicolor detection system
Manufactured by Bio-Rad
Sourced in United States, Italy
The IQ5 multicolor detection system is a real-time PCR instrument designed for quantitative analysis of gene expression and nucleic acid detection. It features a 96-well format and supports up to 5 fluorescent channels for multiplexing experiments.
Automatically generated - may contain errors
Lab products found in correlation
Random hexamer, by Thermo Fisher Scientific (4 mentions)
Tri reagent, by Merck Group (4 mentions)
Sybr green master mix, by Bio-Rad (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Nanodrop 2000 2000c spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Sybr green realtime master mix, by Toyobo (2 mentions)
Revertra ace rt pcr kit, by Toyobo (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Hairpin it mirnas qpcr quantification kit, by GenePharma (1 mentions)
Rt pcr kit, by Toyobo (1 mentions)
Rnu44, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman assay, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr kit, by Takara Bio (1 mentions)
Trizol rna extraction, by Thermo Fisher Scientific (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Revertra ace α rt pcr kit, by Toyobo (1 mentions)
18 protocols using iq5 multicolor detection system
1
Quantifying miRNA and mRNA Expression in CRC
2
Cardiac Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the heart tissues using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions, and reverse-transcription–polymerase chain reaction (RT-PCR) was performed using a TOYOBO RT-PCR kit. After purification, real-time RT-PCR analysis of the expression of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), skeletal α-actin (SAA), and sarcoplasmic reticulum Ca2+ adenosine triphosphatase (SERCA2a) was performed using a Bio-RAD IQ5 multicolor detection system (all the primers are listed in Table 1 ). The melting curves and quantification were analyzed using Bio-RAD software. The comparative cycle threshold method was used to determine the relative RNA expression levels. Each of the PCRs was repeated at least 3 times.
3
Comprehensive Transcriptome Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using TRIzol Reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. qRT–PCR was used to confirm the expression levels of mRNAs and miRNAs.
The single-tube TaqMan miRNA (Assay ID 000498, Applied Biosystems, Life Technologies) was used to detect and quantify mature miR-199a-5p according to the manufacturer's instructions, by the use of iQ5 multicolor detection system (Bio-Rad, Berkeley, CA, USA). miR-199a-5p expression was normalized on RNU44 (Applied Biosystems, Assay Id 001094).
For mRNA detection, oligo-dT-primed cDNA was obtained using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and then used as template to quantify VEGF-A(hs00900054_m1), IL-8 (hs00174103_m1), IL-6(hs00985639_m1), FGFb (hs00266645_m1), MMP-2(hs01548727_m1), CXCR4(hs00237052_m1), SNAIL (hs00195591_m1), VCAM1(hs01003370_m1), ICAM1(hs00277001_m1), AKT1 (hs00920512_m1) levels by TaqMan assay (Applied Biosystems); normalization was performed with B-actin. Comparative real time polymerase chain reaction (RT–PCR) was performed in triplicate, including no-template controls. Relative expression was calculated using the comparative cross threshold (Ct) method.
The single-tube TaqMan miRNA (Assay ID 000498, Applied Biosystems, Life Technologies) was used to detect and quantify mature miR-199a-5p according to the manufacturer's instructions, by the use of iQ5 multicolor detection system (Bio-Rad, Berkeley, CA, USA). miR-199a-5p expression was normalized on RNU44 (Applied Biosystems, Assay Id 001094).
For mRNA detection, oligo-dT-primed cDNA was obtained using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and then used as template to quantify VEGF-A(hs00900054_m1), IL-8 (hs00174103_m1), IL-6(hs00985639_m1), FGFb (hs00266645_m1), MMP-2(hs01548727_m1), CXCR4(hs00237052_m1), SNAIL (hs00195591_m1), VCAM1(hs01003370_m1), ICAM1(hs00277001_m1), AKT1 (hs00920512_m1) levels by TaqMan assay (Applied Biosystems); normalization was performed with B-actin. Comparative real time polymerase chain reaction (RT–PCR) was performed in triplicate, including no-template controls. Relative expression was calculated using the comparative cross threshold (Ct) method.
4
Quantitative RT-PCR Analysis of Adipocyte Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRI Reagent was used for RNA extraction (Sigma-Aldrich) and quantified with the NanoDrop 2000/2000c Spectrophotometer (Thermo Fisher Scientific) and the quality was monitored using 1.5% agarose gels run in MOPS buffer, pH 7.1 (0.4 M MOPS (3-(N morpholino)propanesulfonic acid), 0.1 M NaAc, 20 mM EDTA (Ethylenediaminetetraacetic acid)), and 10% formaldehyde. cDNA was synthesized from 1 µg RNA using SuperScript III reverse transcriptase at 42 °C and 2.5 µM random hexamers (Life Technologies). Quantitative RT-PCR (Q-RT-PCR) was performed using the SYBR™ Green master mix (Bio-Rad, Milan, Italy) and the iQ5 multicolor detection system (Bio-Rad). One cycle of 3 min at 95 °C was followed by 45 cycles of 10 s at 95 °C, 10 s at 60 °C, and 20 s at 72 °C, followed by a melting curve. mRNA levels are normalized to GAPDH expression as described in [35 (link)], and 2−ΔΔCt values calculated. Relative gene expression was determined using the comparative threshold cycle Ct method, normalizing for housekeeping genes (GAPDH) such that the average the expression ratio was calculated as 2−ddCt. The primers for adipocyte specific gene amplification were: PPARγ2, FWD CCTATTGACCCAGAAAGCGATT, REV CATTACGGAGAGATCCACGGA); FABP4 (FWD TGGGCCAGGAATTTGACGAA, (REV GACGCATTCCACCACCAGTT); ADIPO-Q, FWD AGGGTGAGAAAGGAGATCC, REV GGCATGTTGGGGATAGTAA.
5
Quantitative RT-PCR Analysis of Osteogenic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from 1 μg RNA, extracted using TRIzol (Life Technologies) and controlled by NanoDrop quantification, using SuperScript III (Life Technologies). Cycling conditions of 95 °C for 3 min, followed by 45 cycles of 95 °C (10 s), 60 °C (10 s), and 72 °C (10 s), were performed and analyzed on a Bio-Rad iQ5 multicolor detection system (Bio-Rad, Milan, Italy). Analysis of relative gene expression was calculated as 2−ddCt. Primers used for Q-RT-PCR were: GAPDH: forward 5′-CACCATCTTCCAGGAGCGAG-3′ and reverse 5′-TCACGCCACAGTTTCCCGGA-3′; ZNF521: forward 5’-TGGGATATTCAGGTTCATGTTG-3′ and reverse 5′-ACTGGAGTTTGGCAGGAGAG-3′; ALP: forward 5′-TAA GGACATCGCCTACCAGC-3′ and reverse 5′-TGGCTTTCTCGT CACTCTCA-3′; OSX forward 5′-CCCAGGCAACACCCTACTC-3′ and reverse 5′-GGCTGGATTAAGGGGAGCAAA-3′ OPN forward 5′-CTCCATTGACTCGAACGACTC-3′ and reverse 5′-CAGGTCTGCGAAACTTCTTAGAT-3′.
6
Quantification of Gene Expression in Apple
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaf and root samples using the Wolact plant RNA extraction kit (Vicband, Hong Kong, China). Complementary DNA was then reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time). The real-time quantitative PCR (qRT-PCR) reactions were carried out using the SYBR Green qPCR kit (TaKaRa, Tokyo, Japan) and the iQ5 Multicolor Detection System (Bio-Rad Laboratories, Hercules, United States). Perini et al. (2014) (link) showed that MdMDH (malate dehydrogenase gene) were found to be the most stable and suitable normalizers for all apple tissue expression analyses by RT-qPCR. Therefore, MDH was used as an internal standard. The specific primer sequences used for qRT–PCR are provided in Supplementary Table S1 . At 0, 3, 12, 24 h, 3, 5, 10, and 15 days after alkali stress treatment, leaves and roots were randomly selected for measurement.
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared by RNA-TRIZOL extraction (Gibco, Nanjing, China). The concentration and the purity of the extracted RNA were measured spectrophotometrically at A260 and A280. Real-time reverse transcription-polymerase chain reaction (real-time PCR) was performed byusing the TOYOBO ReverTra Ace RT-PCR kit according to the manufacturer’s instructions. The primers were F: 5'-AAGCTGTGCATCTACACCGA-3'/R: 5'-CTTGAGCTTGTTCACCAGGA-3'; for mouse cyclin D1 [42 (link)]; F: 5'-AGGATAAAGTCTAGGTCCAGGAGGTCGTTG-3' R: 5'-AGTCGTAGTCGAGGTCATAGTTCCTGTTGG-3' for mouse c-myc [43 (link)]; 5'-GAAGGTGAAGGTCGGAGTC-3'/R: 5'-GAAGATGGTGATGGGATTTC-3' for mouse GAPDH and F: 5'-CGCTTTGCTGAGGTCTATAAGGC-3'/R: 5'-GATATTGGAGCTCTTGAGGTCCCT-3' for mouse TGFRII. A typical reaction (50 μL) contained 1/50 of reverse transcription-generated cDNA and 200 nM of primer in 1× SYBR Green Real-Time Master Mix (Toyobo, Shanghai, China) buffer. The PCR reactions were carried out on a Bio-Rad IQ5 multicolor detection system by using 2 μg of synthesized cDNA under the following conditions: 95 °C for 5 min, 40 cycles at 95 °C for 15 s, 60 °C for 15 s and 72 °C for 30 s. All real-time PCRs were performed at least in triplicate. The value was always normalized to the control group.
8
Differential Gene Expression in Ae. aegypti Lifecycle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Different developmental stages of Ae. aegypti such as eggs, larvae (first to fourth-instar), pupae, adult males or females were collected in RNAlater and stored at −80 °C. Total RNA was isolated from these samples using RNeasy mini kit (Qiagen, Hilden, Germany) with slight modification by adding 30 μL β-mercaptoethanol (2-ME) per 1 mL RLT buffer. First-strand cDNA was synthesized using QuantiTect reverse transcription kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions followed by qPCR using SYBR green supermix in an IQ5 multicolor detection system (Bio-Rad, Hercules, CA, USA), where the mRNA for mosquito ribosomal protein subunit S6 gene was used as a normalization control [56 (link)]. The primer sets of representative genes used for expression analyses are mentioned in supplementary Table S1 . Following PCR cycle parameters were used, initial denaturation at 95 °C for 3 min, 35 cycles of 10 s at 95 °C, 40 s at 55 °C, and 1 min at 72 °C. The fluorescence readings were taken after each cycle. A final extension at 72 °C for 10 min was performed followed by a melting curve analysis.
9
Cardiac Fibroblast Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from the left ventricular tissues of human hearts, mouse hearts, or cultured cardiac fibroblasts (cFBs) by using TRIzol reagent (Invitrogen, catalogue 15596–018, USA). cDNA was synthesized from 1-mg RNA of each sample by using the TOYOBO ReverTra Ace-α-RT-PCR kit according to the manufacturer’s instruction. Real-time PCR was performed on a Bio-Rad IQ5 multicolor detection system by using synthesized cDNA. A comparative CT method was used to determine relative quantification of special RNA levels. All real-time PCRs were performed at least in triplicates. Collagen type I (Coll. I), collagen type III (Coll. III), atrial natriuretic peptide (ANP), B-type natriuretic peptide (BNP), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were amplified by using their specific primers listed in supplementary table 1 .
10
Quantitative RT-PCR Analysis of Hematopoietic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with the TRI Reagent (Sigma-Aldrich, Milan, Italy). cDNA was synthesized from 1 µg RNA using SuperScript III reverse transcriptase at 42 °C and 2.5 µM random hexamers (Life Technologies, Monza, Italy). Quantitative RT-PCR (Q-RT-PCR) was run using the SYBR™ Green master mix (Bio-Rad, Milan, Italy) and was analyzed using an iQ5 multicolor detection system (Bio-Rad, Milan, Italy). One cycle of 3 min at 95 °C was followed by 45 cycles of 10 s at 95 °C, 10 s at 60 °C, and 20 s at 72 °C followed by a melting curve. The results are expressed as mRNA levels normalized to the GAPDH mRNA expression in each sample [76 (link)]. To determine the mRNA levels, at least three independent RNA samples were analyzed.
The primer sequences used for the Q-RT-PCR were:
GAPDH, FWD: CACCATCTTCCAGGAGCGAG and REV: TCACGCCACAGTTTCCCGGA;
ZNF521, FWD: CCACATCCAAACCATCCACCG and REV: CAGGTGGCACTGGAGTTTGGC; MLL-AF9 break-point FWD: CACCTACTACAGGACCGCCAA and REV: CTAGGTATGCCTTGTCACATTCACC;
HOXA10 FWD: CTTCCGAGAGCAGCAAAGCCTC and REV: TCCAGTGTCTGGTGCTTCGTGT;
HOXA9 FWD: CCCCATCGATCCCAATAACC and REV: TCACTCGTCTTTTGCTCGGT
MEIS1 FWD: AAGCAGTTGGCACAAGACACG and REV: TGTCCATCAGGATTATAAGGTGTTCC;
MEF2C FWD: TCCACCAGGCAGCAAGAATACG and REV: GGAGTTGCTACGGAAACCACTG;
PBX3 FWD: CCAGTGAAGAAGCCAAAGAGGAG and REV: CAGCATAGAGGTTGGCTTCTTCC.
The primer sequences used for the Q-RT-PCR were:
GAPDH, FWD: CACCATCTTCCAGGAGCGAG and REV: TCACGCCACAGTTTCCCGGA;
ZNF521, FWD: CCACATCCAAACCATCCACCG and REV: CAGGTGGCACTGGAGTTTGGC; MLL-AF9 break-point FWD: CACCTACTACAGGACCGCCAA and REV: CTAGGTATGCCTTGTCACATTCACC;
HOXA10 FWD: CTTCCGAGAGCAGCAAAGCCTC and REV: TCCAGTGTCTGGTGCTTCGTGT;
HOXA9 FWD: CCCCATCGATCCCAATAACC and REV: TCACTCGTCTTTTGCTCGGT
MEIS1 FWD: AAGCAGTTGGCACAAGACACG and REV: TGTCCATCAGGATTATAAGGTGTTCC;
MEF2C FWD: TCCACCAGGCAGCAAGAATACG and REV: GGAGTTGCTACGGAAACCACTG;
PBX3 FWD: CCAGTGAAGAAGCCAAAGAGGAG and REV: CAGCATAGAGGTTGGCTTCTTCC.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!