Mouse anti ha

Proteins separated by 4%–12% SDS-PAGE were transferred to a nitrocellulose membrane using the iBlot Western blot kit (Invitrogen) and analyzed using mouse monoclonal anti-FLAG (MilliporeSigma, F3165-1MG, 1:2000 dilution), mouse anti-HA (BioLegend, clone 16B12, catalog 901502, 1:1000 dilution), and mouse anti-GFP (Santa Cruz, SC-9996, 1:2000 dilution) primary antibodies. The antibody-antigen complexes were detected using horseradish peroxidase–conjugated bovine anti-mouse (Santa Cruz, SC-2371, 1:10,000 dilution) secondary antibody and enhanced chemiluminescence (ECL) reagents obtained from GE Healthcare. PDE6C and PDE6C^R565Q protein expression levels were quantified using analysis of immunoblot data with NIH ImageJ software according to the user guide.

Antibodies used in this study include affinity-purified rabbit anti-Mad1 antibodies prepared against amino acids 333–617 of human Mad1^{2 (link)} and diluted 1:3000 for western blots and 1:2000 for immunofluorescence, mouse anti-SUMO1 (21C7, Developmental Studies Hybridoma Bank) diluted 1:250, mouse anti-Myc (9E10, Developmental Studies Hybridoma Bank) diluted 1:200, mouse anti-tubulin (12G10, Developmental Studies Hybridoma Bank) diluted 1:5000, rabbit anti-GFP (#2555S, Cell Signaling), mouse anti-p53 (DO-1, #sc-126, Santa Cruz), rabbit anti-p53 (#NB200-171, Novusbio), mouse anti-actin (JLA20, Developmental Studies Hybridoma Bank) diluted 1:500, rabbit anti-tubulin (#2144S, Cell Signaling), rabbit anti-p21 (#ab188224, Abcam), rabbit anti histone H3 (# 9715S, Cell Signaling), mouse anti-FLAG M2 (Sigma) diluted 1:2500, rabbit anti-PML (sc-5621) diluted 1:500, and mouse anti-HA (#901501, Biolegend), and pan-cytokeratin antibody (AE1 + AE3 conjugated to Alexa Fluor® 647, Novus, cat. no. NBP2-33200AF647).

BG2-c2 cells were fixed in 4% formaldehyde/PBS for 10 min and permeabilized with PBST-0.2 (PBS, 0.2% Triton X-100) or saponin/PBS-0.1 (PBS, 0.1% saponin; for TMR-Dex-labeled cells only) for 10 min, blocked with 1% BSA/PBS 30 min, and incubated with primary antibodies in 1% BSA/PBS for 1 h at room temperature. The following antibodies were used: rat anti-Abi at 1:100, mouse anti-HA (BioLegend) at 1:100, and rabbit anti-Myc (Cell Signaling Technology) at 1:100. FITC- and Cy5-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories) were used at 1:200. Actin filaments were stained with 6.6 μM rhodamine-phalloidin (Molecular Probes). For each cell, single confocal slice or Z stack of optical sections (0.33 μm) were taken with an LSM 800 confocal microscope using a Plan Apo ×63 1.4 Oil objective.

Constructs evaluated in HEK cell membrane display were cloned into the pPPI4 vector (Sanders et al., 2002 (link)) containing a C-terminal gpi anchor motif. Small-scale 2–5 mL HEK cell cultures were transfected with PEI as above. Cells were stained for flow cytometric analysis essentially as for yeast above; 1.5–2.5e5 cells were washed in PBSF three times prior to incubation in primary antibody at desired concentration and 1:200 mouse anti-HA (Biolegend) in 50 μL. Cells were washed three times, and stained with anti-hu Fd-FITC (ThermoFisher) at a 1:500 dilution and goat anti-mouse (H + L) Alexa Fluor 488 (Life Technologies); or with 1:1000 dilutions of anti-hu (H + L) Alexa Fluor 647 and anti-mouse (H + L) Alexa Fluor 488 (both Life Technologies); and a 1:40 dilution of calcein violet live-dead stain (ThermoFisher).
For analysis, cells were first gated on forward and side scatter, followed by gating on calcein violet for live cells. Cells expressing protein were gated using anti-HA antibody signal, and the resulting median fluorescence intensity was quantified as a measure of antibody binding.

Adult fly brains were dissected in cold phosphate-buffered saline with 0.1% Triton-X (PBST) and fixed in 4% formaldehyde for 20–35 min. Brains were rinsed 3 X 15 min with PBST, blocked for 60 min in 5% normal donkey serum in PBST (NDST), and incubated for 24 hrs at RT in primary antibody diluted in NDST. Brains were then rinsed 3 X 15 min in PBST, incubated for 24 hrs in secondary antibody diluted in NDST, rinsed 3 X 15 min in PBST, cleared for 5 min in 50% glycerol in PBST, and mounted in Vectashield. Primary antibodies were as follows: rabbit anti-GFP 1:1000 (Molecular Probes A-11122), rat anti-RFP 1:1000 (Chromotek 5F8), mouse anti-HA 1:250 (BioLegend 901501), rabbit anti-SIFa 1:4000 (gift of J. Veenstra), and guinea pig anti-PERIOD 1:1000 (UPR 1140; gift of A. Sehgal). Secondary antibodies were as follows: FITC donkey anti-rabbit 1:1000 (Jackson 711-095-152), Cy3 donkey anti-rat 1:1000 (Jackson 712-16-150), Cy5 donkey anti-mouse 1:1000 (Jackson 715-175-151) and Cy3 donkey anti-guinea pig 1:1000 (Jackson 706-165-148). Immunolabeled brains were visualized with a Fluoview 1000 confocal microscope (Olympus). Trans-Tango flies were raised at 18°C and dissected ~2 weeks post-eclosion to maximize signal intensity [25 (link)].

The following antibodies were used for immunofluorescence staining: mouse anti-HA (1:500, Roche) and goat-anti-mouse Alexa 488 (1:400, Thermo Fisher Scientific). The following antibodies were used for western blot: mouse anti-HA (1:2,000, BioLegend), rabbit anti-GFP (1:10,000, Abcam), goat anti‐mouse IRDye800CW (1:15.000, LI‐COR), and goat‐anti‐rabbit IRDye680LT (1:20,000, LI‐COR). A reagent used in this study is rapalog (AP21967, TaKaRa).
The following DNA expression constructs in this study have been described before: GW1–PEX3–mRFP–FKBP1, β-actin–Kif1A_MDC–FRB (Kevenaar et al., 2016 (link)) (mouse cDNA), BirA coding vector (van der Vaart et al., 2013 (link)), and pebioGFP (van der Vaart et al., 2013 (link)). pGW1–HA–KBP contained a linker (GGATCCCCGGAATTCGGCACGAGGGAGGCCGCT) between the HA tag and KBP and was cloned using PCR-based strategies with human KBP cDNA (KIAA1279, IMAGE clone 4550085) as template and ligation into the pGW1–HA backbone. A similar strategy was used to generate the mutated KBP constructs, listed in Table 2. β-actin–KIF15_MDC–FRB was cloned using a PCR-based Gibson Assembly strategy with mouse KIF15 cDNA as template into the β-actin–KIF1A_MDC–FRB backbone. PebioGFP-KIF1A_MDC and pebioGFP-KIF15_MDC were cloned into the pebioGFP backbone using PCR-based strategies with MDC–FRB constructs as templates.