Log In Sign up
The largest database of trusted experimental protocols

Standard 24 well boyden control and invasion chambers

Manufactured by BD
Visit Supplier

The Standard 24-well Boyden control and invasion chambers are laboratory equipment used to study cell migration and invasion. These chambers consist of an upper and a lower compartment separated by a porous membrane. Cells are seeded in the upper compartment, and their ability to migrate through the membrane or invade a matrix coated on the membrane can be measured.

Automatically generated - may contain errors

Lab products found in correlation

Celltiter 96 aqueous one solution cell proliferation assay mts kit, by Promega (1 mentions)

Close spelling variants of this product

Boyden chambers (167 citations) Invasion chambers (38 citations) 24-well Boyden chambers (19 citations) 24-well invasion chambers (10 citations) 24-well control chamber (4 citations) Invasion Boyden chambers (3 citations) Control chambers (2 citations)

3 protocols using standard 24 well boyden control and invasion chambers

1

Boyden Chamber Cell Migration Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Standard 24-well Boyden control and invasion chambers (BD Biosciences) were used to assess cell migration and invasion following manufacturer suggestions. Details are in the Supplemental Information.
Liu J., Cho S.N., Akkanti B., Jin N., Mao J., Long W., Chen T., Zhang Y., Tang X., Wistub I.I., Creighton C.J., Kheradmand F, & DeMayo F.J. (2015). ErbB2 Pathway Activation upon Smad4 Loss Promotes Lung Tumor Growth and Metastasis. Cell reports, 10(9), 1599-1613.
+ Open protocol
+ Expand
2

Boyden Chamber Cell Migration Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Standard 24-well Boyden control and invasion chambers (BD Biosciences) were used to assess cell migration and invasion following manufacturer suggestions. Details are in the Supplemental Information.
Liu J., Cho S.N., Akkanti B., Jin N., Mao J., Long W., Chen T., Zhang Y., Tang X., Wistub I.I., Creighton C.J., Kheradmand F, & DeMayo F.J. (2015). ErbB2 Pathway Activation upon Smad4 Loss Promotes Lung Tumor Growth and Metastasis. Cell reports, 10(9), 1599-1613.
+ Open protocol
+ Expand
3

Cell Proliferation and Migration Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
We utilized CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) kit (# G3582) from Promega to examine cell proliferation (16). Standard 24-well Boyden control and invasion chambers (BD Biosciences) were used to assess cell migration and invasion following manufacturer suggestions. We cloned shRNAs into pGPU6/GFP/Neo vectors. The sequence of shRNA targeting hsa_circ_0001860-2 is "TTACTGAAGCTTCAAGGTTAC"; and the control shRNA sequence is "TTCTCCGAACGTGTCACGT".
Wang L., Zheng P., Cao W., Sun X., Gao W., & Wang Y. (2020). Characteristics of Circular RNA Expression in Ishikawa Human Endometrial Carcinoma Cells with Progesterone Treatment.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!