Microrna assay

Total RNA was first extracted from the nasal secretions using MirVana miRNA isolation kit (Invitrogen, AM1560), following enrichment procedure for small RNAs as per manufacturer’s protocol. For normalization we added a spike-in (Cel-mir-39-3p, sequence 5’-UCACCGGGUGUAAAUCAGCUUG-3’, ThermoFisher miRNA mimic, Assay ID# MC10956, cat# 4464066) to the viral nasal wash prior to mirVana mirna isolation protocol. Extracted RNA was then reverse transcribed into cDNA. Quantitative real-time RT-PCR was used to measure miR-155 and Cel-mir-39 levels (TaqMan assay, ThermoFisher, MA, USA). The following primers were used: Cel-mir-39 primer (ThermoFisher MicroRNA assay, Assay ID: 000200) Stem-loop sequence of primer 5’UAUACCGAGAGCCCAGCUGAUUUCGUCUUGGUAAUAAGCUCGUCAUUGAGAUUAUCACCGGGUGUAAAUCAGCUUGGCUCUGGUGUC-3’HSA-mir-155 primer (ThermoFisher MicroRNA assay, Assay ID: 002623)
Stem-loop sequence of primer 5’UUAAUGCUAAUCGUGAUAGGGGUUGUUCUUAUUAACAGACACCUAACAUGUUAGCAUUAGCU-3’The delta Ct (ΔΔCt) method was used to calculate final miR-155 levels normalized to a spike-in control (Cel-mir-39, ThermoFisher, MA, USA).

Total RNA was extracted from the collected fresh-frozen tissue specimens using the standard Trizol method; miRNA expression was measured with the microRNA assay (Applied Biosystems Inc, US). The expression analysis is described briefly as follows. First, 25 ng of total RNA were reverse-transcribed to cDNA using the TaqMan^® MicroRNA Reverse Transcription Kit (Applied Biosystems Inc., US). The reverse transcription (RT) was completed sequentially under the following conditions: incubation at 16°C for 30 minute, 42°C for 30 minute and 85°C for 5 minute. After RT, quantitative polymerase chain reaction (qPCR) was performed in the 7900 HT-Fast real-time PCR system (Applied Biosystems Inc., US) following the protocol of denaturing at 95°C for 10 minute, and 40 cycles of denaturing at 95°C for 15 second and annealing and elongation at 60°C for 1 minute. The qPCR results were analyzed with the SDS Relative Quantification Software version 2.1 (Applied BioSystems Inc., US). Small RNA RNU6 was utilized as an endogenous control to normalize the quantity of cDNA used for analysis of miR-195 expression. All samples were analyzed in triplicate, and the measurement was repeated if the coefficient of variation was greater than 5%. The expression level of miR-195 was calculated based on the formula 2^−△△Ct, where ∆Ct = Ct _(miR-195)–Ct_(RNU6).

According to the protocol, the Trizol reagent (Invitrogen) extracted the total RNA of CC cells. Next, the complementary DNA (cDNA) was obtained by transcribing RNA. RNA and cDNA quality was determined by Bioanalyzer (Agilent). The commercialized cDNA Reverse Transcription kit (Applied Biosystems, USA) was used. The level of qRT-PCR was assessed with the MicroRNA Assay and TaqMan® Universal PCR Master Mix (Applied Biosystems, USA) under the thermocycler conditions: 95°C for 5 min, and 40 cycles of 95°C for 5 s and 60°C for 31s, followed by 75°C for 40s. Besides, qRT-PCR was implemented to measure the level of mRNA and miRNA under the specific thermocycler conditions according to the agreement of the commercialization kit [21 (link)]. The primers were obtained from TAKARA (Beijing, China) and listed in Table 1.