Total RNA was extracted from the testes of at least five 15-week-old mice per genotype using an RNApure kit (Bioteke, Beijing, China). One microgram of total RNA was reverse transcribed using a RevertAid First Strand cDNA Synthesis Kit (Fermentas, Pittsburgh, PA, USA) with oligo(dT) primers. The sequence of interest in the Znf230 gene was amplified using two gene-specific primers: E4f: 5′-cccatcctcggtcacatctt-3′, located within the sequence of Exon-4, and E6r: 5′-cccccttctcctctacgacaac-3′, the reverse complement primer of a sequence located within Exon-6. A 982 bp fragment corresponding to the mouse Gapdh gene was co-amplified as an internal control using the following primers: 5′-tgaaggtcggtgtgaacggatttggc-3′ (Forward) and 5′-catgtaggccatgaggtccaccac-3′ (Reverse). Three independent RT-PCR analyses were performed to validate the results.
Rnapure kit
Manufactured by BioTeke
Sourced in China
The RNApure kit is a laboratory product designed for the extraction and purification of ribonucleic acid (RNA) from biological samples. It is a tool used in scientific research and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (5 mentions)
Sybr green, by BioTeke (2 mentions)
Ssoadvanced sybr green supermix, by Bio-Rad (2 mentions)
Cfx96 touch real time system, by Bio-Rad (2 mentions)
Mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
Taq hs perfect mix, by Takara Bio (1 mentions)
One step primescript mirna cdna synthesis kit, by Takara Bio (1 mentions)
Sybr primescript mirna rt pcr kit, by Takara Bio (1 mentions)
Sygb premix ex taq, by Takara Bio (1 mentions)
Transscript 2 one step gdna removal and cdna synthesis supermix kit, by Transgene (1 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Rnasin, by Takara Bio (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript mirna cdna synthesis kit, by Takara Bio (1 mentions)
Sybr green master mix, by Vazyme (1 mentions)
16 protocols using rnapure kit
1
Analyzing Znf230 Gene Expression in Mouse Testes
2
Kidney gene expression profiling in T2DM
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the frozen kidneys with RNApure kit (Bioteke, Beijing, China) according to the instructions of the manufacturer. Strand cDNA was synthesized by Plus All-in-one 1st Strand cDNA Synthesis SuperMix kit (NovoScript, Beijing, China) according to the instructions of the manufacturer. Twelve genes were selected to analyze their mRNA expression differences. The primers of these genes were listed in Table 1 . The expression levels of genes were measured by 7500 FAST Real-Time PCR System (Thermo Fisher Scientific, United States). Gene expression levels were performed by 2 × Plus SYBR real-time PCR mixture according to the instructions of the manufacturer and quantified relatively to the expression of the GAPDH by using an optimized comparative Ct (△△Ct) value method which was calculated as 2∧ (△△Ct) to compare the relative expression.
The whole process of biochemical indicators test, Hematoxylin-eosin staining and gene expression profiles of kidney at different time point of animal model of T2DM is shown inSupplementary Table 1 .
The whole process of biochemical indicators test, Hematoxylin-eosin staining and gene expression profiles of kidney at different time point of animal model of T2DM is shown in
3
Quantification of miR-183-5p and PTEN mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the ischemic penumbra or N2A cells using the RNApure kit (BioTeke Corporation) according to the manufacturer's instructions. To determine miR-183-5p or PTEN mRNA expression, reverse transcription was performed using M-MLV Reverse Transcriptase (2641A, Takara Biotechnology Co., Ltd.) according to the manufacturer's directions. Real-time PCR was subsequently conducted using Taq™ HS Perfect Mix (Takara Biotechnology Co., Ltd.) and SYBR® Green (BioTeke Corporation). The forward and reverse primers of miR-183-5p, U19, PTEN and β-actin used for real-time PCR were as follows: miR-183-5p, 5′-GCGGCTATGGCACTGGTAGAA-3′ and 5′-GTGCAGGGTCCGAGGTATTC-3′; U19, 5′-TGTGGAGTTGGTCCTGGTCT-3′ and 5′-GTGCAGGGTCCGAGGTATTC-3′; PTEN, 5′-GACCATAACCCACCACAGC-3′ and 5′-CATTACACCAGTCCGTCCCT-3′; β-actin, 5′-AATCGTGCGTGACATCAA-3′ and 5′-AGAAGGAAGGCTGGAAAA-3′. Relative miR-183-5p was calculated using the 2−ΔΔCq method (24 (link)) and normalized to U19. Relative PTEN expression was calculated using the same method and normalized to β-actin.
4
Total RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using RNApure kit (BioTeke, Beijing, China) according to the manufacturer’s instructions. RNA purity was determined from the ratio of optical density value (OD260/280) in range of 1.8–2.1. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with a Stratagene Mx3005P QPCR system (Agilent, Biosystems, Forest City, CA, USA). (See also supplementary materials and methods ).
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNApure kit (BioTeKe corporation, Jiangsu, China). was used for extracting total RNA from brain tissue. The mass and concentration of RNA were measured by ultraviolet-visible spectrophotometry (ND-1000, Nanodrop, USA). cDNA was synthesized using the TaKaRa PrimeScript RT reagent kit with gDNA Eraser. qRT-PCR was conducted using TaKaRa SYGB Premix EX Taq (Tli RNaseH Plus, CA). For miRNA analysis, the One Step PrimeScript miRNA cDNA Synthesis Kit (TaKaRa) and the SYBR PrimeScriptTM miRNA RT-PCR Kit (TaKaRa) were used. Primers used are listed in Supplementary Table 1. U6 was the endogenous reference of miR-150-5p, and glyceraldehyde-3-phosphate dehydrogenase was the internal reference of the remained genes. The gene expression was calculated by 2−ΔΔCt method [33 (link),34 (link)].
6
Comparing rictor Gene Expression in B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For comparison of rictor gene expression in WT and Rictor KO B cells, RNA was isolated with RNAPURE kit (RP1202; BioTeke) and reverse transcribed with a PrimeScript RT reagent Kit (RR037A; Takara). The transcribed cDNA was used to analyze the expression of different genes with SsoAdvanced SYBR Green supermix (Bio-Rad) on a CFX96 Touch Real-Time System (Bio-Rad). rictor 5’primer:tgcgatattggccatagtga and 3’primer: acctcgttgctctgctgaat.
7
RNA Extraction and Transcription Analysis of Streptomyces lincolnensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, mycelia of S. lincolnensis original strain SyBE2901 and the lmbU deletion strain SyBE2904 were collected from 25-ml culture (3 days of growth in fermentation medium) by centrifugation, and ground into powder in liquid nitrogen. Total RNA was extracted using RNApure kit (Bio Teke, China) according to the manufacturer’s protocol.
Reverse transcription was conducted using TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGene Biotech, China). Using gene specific primers (reverse primer used in semi-quantitative PCR) and 500 ng of total RNA as template, the first strand was generated. For analyzing transcription, the 1st cDNA reaction mixture was used as the template to amplify ds-cDNA in the following semi-quantitative PCR. In each case the experiments were conducted in triplicate. The PCR products were detected using agarose gel electrophoresis, and then exposed under UV to analyze relative intensity. Primers used in semi-quantitative PCR experiments were listed in Additional file1 : Table S2.
Reverse transcription was conducted using TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransGene Biotech, China). Using gene specific primers (reverse primer used in semi-quantitative PCR) and 500 ng of total RNA as template, the first strand was generated. For analyzing transcription, the 1st cDNA reaction mixture was used as the template to amplify ds-cDNA in the following semi-quantitative PCR. In each case the experiments were conducted in triplicate. The PCR products were detected using agarose gel electrophoresis, and then exposed under UV to analyze relative intensity. Primers used in semi-quantitative PCR experiments were listed in Additional file
8
Comparative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To make a comparison of the gene expression of cd19, btk and was in splenic B cells from WT and AKT2 KO mice, total RNA was isolated by RNAPURE kit (RP1202; BioTeke) from 1 × 106 B cells, and was then reversed into cDNA by using PrimeScript™ RT reagent Kit (Takara). The gene expression was detected by CFX96 TouchTM equipment (Bio-Rad) with RT-PCR Assay Kit (Qiagen). Gapdh was used to standardize mRNA expression. Primers for Cd19, Btk and Was were as follows: Cd19 Forward 5′-GGACAGTGAACGTGGAGGAT-3′, Cd19 Reverse 5′-GGGCACATACAGGCTTTGTT-3′. Btk Forward 5′-CGCCATTACGTTGTGTGTTC-3′, Btk Reverse 5′-TAGAAGGCGCGTTTTTGTTT-3′. Was Forward 5′-CCAACTGATAAGAAACGCTCAG-3′, Was Reverse 5′-CTGACATGTTTGAATCCACTCG-3′. Gapdh Forward 5′-TGCCCCCATGTTTGTGATG-3′, Gapdh Reverse 5′-TGTGGTCATGAGCCCTTCC-3′.
9
Quantification of med-ORF12 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with the RNApure kit (BioTeke) from the mycelia of CH999/pIK340 and CH999/pIK340‐Δmed10 (med‐ORF10‐deficient strain) after cultivation on R4 plates for 5 d. RNasin (Takara)‐ and DNase I (Takara)‐treated RNA (1 mg) was used as the template for reverse transcription with random hexamers and reverse transcriptase M‐MLV (Promega). The qRT‐PCR using resultant cDNA samples was performed with the Premix DimerEraser® (Perfect Real Time) (TaKaRa, Japan) according to the manufacturer’s instructions on Applied Bio systems QuantStudio™ 3 Real‐Time PCR System (Applied Biosystems Inc., Waltham, MA, USA). Primer pairs for amplification of proposed targets and 23S rDNA (Table S1 ) were used to produce PCR products ranging from 250 to 400 bp. The experiment was independently conducted in triplicates. The relative mRNA expression of med‐ORF12 was calculated using the 2‐∆∆CT method (Livak and Schmittgen, 2001 (link)).
10
Quantifying miRNA-30a-3p in Osteosarcoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cultured MG63 cells, 143B and Saos-2 cells was extracted with an RNApure kit (Bioteke, Beijing, China) according to the manufacturer’s instructions. Total cDNA was reverse transcribed by using PrimeScript RT reagent Kit (Takara, Dalian, China) and miRNA cDNA was reverse transcribed by one step PrimeScript miRNA cDNA Synthesis Kit (Takara, Dalian, China). MystiCq® microRNA qPCR Assay Primer hsa-miR-30a-3p (Cat. No. MIRAP00080) was purchased from Sigma. The miRNA levels were detected by qPCR with the ABI 7500 FAST real-time PCR System (Applied Biosystems, Carlsbad, USA) using SYBR Green (Takara, Dalian, China). The reference gene U6 was used in the experiment.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!