Kapa probe fast qpcr kit

For quantification of IFN-α gene expression, total RNA of tissues from tonsils, spleen and mesenteric lymph nodes was extracted using the RNeasy Mini Kit (Qiagen, Hiden, Germany) according to the manufacturer’s protocol. Contaminant genomic DNA was removed by DNase I treatment using a RNase-Free DNase set (Qiagen). Total RNA was quantified and cDNA synthesized using Random Primers (N)₉ (Takara Bio, Shiga, Japan) and SuperScript III Reverse Transcriptase (Life Technologies) in 20 μL reaction mixtures containing 1 μg of total RNA. The cDNA was analyzed by qPCR using the KAPA PROBE Fast qPCR Kit (Kapa Biosystem, Woburn, MA, USA) and a Light Cycler® 480 System II (Roche, Basel, Switzerland). The primers and cycling conditions reported by Lee et al. [23 (link)] were used for IFN-α detection. The gene expression data were normalized by assessing mRNA abundance of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). GAPDH gene expression was quantified by qPCR according to a previous report [24 (link)]. Quantitative values were calculated using the mean of duplicated results. The statistically significant differences were determined using the Student’s t test.

RT was conducted with the iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad, Hercules, CA, USA), and qPCR with the KAPA PROBE FAST qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) and NPTX2 TaqMan Gene Expression Assay (Thermo Fisher Scientific, Inc., Waltham, MA, USA) as described by the manufacturers. Table A2A lists the primers used for qPCR on NPTX2 and GAPDH. Data were normalized to the mRNA level of the internal control GAPDH. Human Thymus Total RNA (Takara, Tsu, Japan) was used as the normal thymus control to calculate the mRNA expression level of NPTX2.

Total RNA was extracted with TRIzol (MDBio, Taiwan). The cDNA was synthesized using M-MLV transcriptase (Promega, MI, USA). The quantitative PCR was performed using KAPA™ PROBE FAST qPCR Kit (KAPABIOSYSTEMS, Boston, Massachusetts, USA) on an Applied Biosystems StepOnePlus™ Real-Time PCR Systems. The CD44 and integrin β3 mRNA expression were analyzed using Maxima SYBR Green qPCR Master Mix kit (Fermentas, Canada). The CD90 primers were 5′-aggacgagggcacctacac-3′ (sense) and 5′-gccctcacacttgaccagtt-3′ (antisense); the CD133 primers were 5′-aaggcatatgaatccaaaattga-3′ (sense) and 5′-ccaccagag gcatcagaataa-3′ (antisense); the CD13 primers were 5′-ca tccatcagagatggcagac-3′ (sense) and 5′-tgctgaagagatcgtt ctgg-3′ (antisense); the CD24 primers were 5′-atgggcagagcaa tggtg-3′ (sense) and 5′-tggaataaatctgcgtgggta-3′ (antisense); the EpCAM primers were 5′-agttggtgcacaaaatactgtcat-3′ (sense) and 5′-ctcccaagttttgagccatt-3′ (antisense); the HPRT primers were 5′-tgatagatccattcctatgactgtaga-3′ (sense) and 5′-caagacattctttccagttaaagttg-3′ (antisense); the CD44 primers were 5′-tttgcattgcagtcaacagtc-3′ (sense) and 5′-gttacaccccaatcttcatgtccac-3′ (antisense) and the β3 integrin primers were 5′-ccgtgacgagattgagtca-3′ (sense) and 5′-aggatggactttccactagaa-3′ (antisense).

HEK-293T cells were transfected with pCXSN-fWNC, pCXSN-prME, and pWNIIrep-GFP using Polyethylenimine Max (Polysciences). After 48 h, the supernatant was collected and cell debris was removed by centrifugation. The supernatants were stored at −80°C until use. Total RNA was isolated from the supernatant using Isogen-LS (Nippon Gene, Tokyo, Japan), according to the manufacturer’s protocol, and was reverse-transcribed with random primers using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). Quantitative PCR was performed with Kapa Probe Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) with the 7500 fast Real-Time PCR system (Thermo Fisher Scientific). The WNV primer and probe sequences used were as follows: WNV forward, 5′-GCACGAAGATCTCGATGTCTAAG-3′; WNV reverse, 5′-ATTCCGCGTTTTAGCATATTGAC-3′; and WNV probe, FAM-5′-ACCAGGAGGGCCCGG-3′-MGB.
The amount of VLPs in the each supernatant was standardized by the amount of replicon RNA packaged in each VLP. SH-SY5Y cells were inoculated with the supernatant with the equivalent amount of VLPs for 24 h. The cells were washed twice with PBS and dissociated with 0.25% trypsin. The GFP signal was measured by a FACS Verse system (BD Biosciences, San Diego, CA, USA).

Total RNA was isolated at the indicated time points using Nucleospin RNA II kit (Macherey-Nagel), and cDNA was synthesized from 200 to 600 ng RNA as previously described [42 (link)]. mRNA expression of GAPDH, IFNβ, IFNα2, viperin and tripartite motif 79α (TRIM79α) were detected by QuantiTect primer assay (Qiagen) and the KAPA SYBR FAST qPCR kit (KAPA Biosystems) using a StepOnePlus fast real-time PCR system (Applied Biosystems). TBEV RNA was quantified using primers previously described [43 (link)] and the KAPA PROBE FAST qPCR kit (KAPA Biosystems). Gene expression was normalized to the endogenous GAPDH expression.

The RNA was purified by HiQ-Column 12 automated DNA/RNA Purification System (Protech, Taiwan) with an AccuPure Yeast RNA mini kit (AccuBioMed, Taiwan). SuperScript™ II Reverse Transcriptase (Invitrogen, USA) was used to convert RNA to cDNA. KAPA ™ PROBE FAST qPCR Kit (KAPAbiosystems, USA) and LightCycler 480 (Roche, USA) were conducted for qPCR analysis. The designer UPL (Universal ProbeLibrary, Roche) primer was shown in Table 1, and Alg9 was used as a reference gene.Table 1

UPL primer sets were used to measure relative quantification of each gene by qRT-PCR

Primer name	Sequence
crtE-UPL#1-F	CGAGATGCTTTCCCTCCATA
crtE-UPL#1-R	TTCGCTAGGACACGTCAGACT
crtI-UPL#155-F	CCGATCCTTCCTTTTACGTG
crtI-UPL#155-R	CGGCACAAGAATGACGATAG
crtYB-UPL#34-F	CACTGATCTTATCTTTCCCTTATCG
crtYB-UPL#34-R	GTGGTCTCGATAGGCGTCTT
tHMG-UPL#119-F	TTCTGCTATGGCGGGTTC
tHMG-UPL#119-R	GCTGTAACCAAATTCGAAGCA
CrBKT-UPL#159-F	GCTGCTGCAACTGGTTCAC
CrBKT-UPL#159-R	GCACTAGCGGAACTAGCAGAA
CZChYb-UPL#157-F	CGCCCACAAATTACACCATT
CZChYb-UPL#157-R	TCCGAAAAACATACCCCAAG
Kan-UPL#144-F	AGACTAAACTGGCTGACGGAAT
Kan-UPL#144-R	CATCAGGAGTACGGATAAAATGC
alg9-UPL#132-F	CAATCAATGGCCCGTATCAT
alg9-UPL#132-R	TGTCTCAGAAGCACAGTTTGG

LGTV infection and viral titers were determined by a focus-forming assay as previously described (41 (link)). Total RNA was isolated at 48 h postinfection using NucleoSpin RNA II kit (Macherey-Nagel) as previously described (41 (link)), and cDNA was synthesized from 500 ng of RNA using a QuantiTect reverse transcription kit (Qiagen) according to the manufacturer's instructions. mRNA expression of actin was detected by a QuantiTect primer assay (Qiagen) and the Kapa SYBR FAST qPCR kit (Kapa Biosystems) using a StepOnePlus fast-real-time PCR system (Applied Biosystems). TBEV RNA was quantified using previously described primers (57 (link)) and a Kapa Probe Fast qPCR kit (Kapa Biosystems).