Cy3 conjugation to GH (Cy3-GH) was performed according to the Cy3 Mono-Reactive dye pack manufacturer’s instructions (GE Healthcare Life Sciences, Amersham, ON, Canada).
Cy3 mono reactive dye pack
The Cy3 Mono-Reactive Dye Pack is a fluorescent labeling reagent used in various biotechnology applications. It is designed to covalently bind to primary amine groups in biomolecules, enabling their detection and visualization in techniques such as Western blotting, immunohistochemistry, and microarray analysis.
Lab products found in correlation
13 protocols using cy3 mono reactive dye pack
Embryonic Brain Hypoxia-Reoxygenation Injury
Cy3 conjugation to GH (Cy3-GH) was performed according to the Cy3 Mono-Reactive dye pack manufacturer’s instructions (GE Healthcare Life Sciences, Amersham, ON, Canada).
Bacterial Strains and Fixation Protocol
Staphylococcus aureus, Streptococcus pneumoniae, and Escherichia coli strains used in this work were clinical isolates from the Russian Ministry of Health Dmitry Rogachev National Medical Research Center Of Pediatric Hematology, Oncology and Immunology collection. Listeria monocytogenes type strain EGDe (serovar 1/2a) was cultivated in the Brain Heart Infusion medium (BHI, BD, USA) at 37°C.
For fixation, bacteria from overnight cultures were precipitated by centrifugation for 5 min at 5000 rpm; the pellet was resuspended in PBS, bacteria were precipitated again, resuspended in 2.5% glutaraldehyde in PBS and incubated for 2 h at 4°C. The final concentration of bacteria was 109 cells/ml. Fixed or live L. monocytogenes cells were labelled with Cy3 (Mono-Reactive Dye Pack, GE Healthcare, Sweden) in accordance with the recommendations of the manufacturer.
Microarray-based IgE Detection
Antigen Internalization Assay using Flow Cytometry
Quantifying Laminin Chain Secretion
Scalable smFISH Probe Production
All primary probes sequences are available online at
Synthesis and Labeling of smFISH Probes
Mouse Tissue RNA Extraction and Labeling
See Janssen et al. [14 (link)] for a more detailed description of the laser dissection procedures, RNA processing and microarray procedures.
DNA Microarray Protein-Binding Assay
The chemicals used were IgE (Fitzgerald), Thrombin (Haematologic Technologies, Inc.), BSA and HSA (Sigma), neuropeptide Y (Pheonix Pharmaceuticals), Illustra NAP-25 desalting columns and Cy3 Mono-Reactive Dye Pack (GE Healthcare), NanoDrop (Thermo Scientific), nuclease free water (Gibco). Microarray equipment consisted of the following: custom 8 × 15 k DNA microarrays, 8 × 15 k gasket slides, ozone barrier slides, hybridization chambers, scanner cassettes, hybridization oven, and High-resolution Microarray Scanner (all Agilent) and slide rack and wash dishes (Shandon) and Kimtech polypropylene wipes (Kimberly-Clark). All DNA was purchased through IDT:
4A018: GGTTGGTTTTTCAATCAGCGATCGCGGAATCCAGGGTTAGGCGGCCAACC (with and without 3′-T10-Biotin moiety).
TFBS: GGTTGGTGTGGTTGG.
Buffers: Binding [PBSMTB]-1x PBS (8.1 mM Na2HPO4, 1.1 mM KH2PO4, 2.7 mM KCl, 137 mM NaCl, pH 7.4) + 1 mM MgCl2 + 0.1% Tween-20 and 1% BSA; Washing [PBSM]-1x PBS (8.1 mM Na2HPO4, 1.1 mM KH2PO4, 2.7 mM KCl, 137 mM NaCl, pH 7.4) + 1 mM MgCl2; Rinse [R]-1/4 dilution of PBSM and nuclease free water.
Lectin Microarray Analysis of MSC Membrane Proteins
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!